MARCHF2 (NM_001005416) Human Untagged Clone

CAT#: SC300950

41335 (untagged)-Human membrane-associated ring finger (C3HC4) 2 (MARCH2), transcript variant 3



  "NM_001005416" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-MARCH2 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSPC240; MARCH-II; MARCH2; RNF172
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001005416 edited
ATGACGACGGGTGACTGCTGCCACCTCCCCGGCTCCCTGTGTGACTGCTCCGGCAGCCCT
GCCTTCTCCAAGGTCGTGGAGGCTACGGGCCTCGGACCGCCCCAGTATGTGGCACAGGTG
ACTTCAAGGGATGGCCGGCTCCTCTCCACCGTCATCCGTGCCTTGGACACACCGAGTGAT
GGTCCTTTCTGCCGGATCTGCCATGAGGGAGCGAACGGGGAGTGCTTGCTGTCCCCGTGT
GGCTGCACCGGCACGCTGGGTGCCGTGCATAAGAGCTGTCTGGAGAAGTGGCTTTCCTCA
TCTAACACCAGCTACTGCGAGCTGTGCCACACGGAGTTTGCAGTGGAGAAACGGCCTCGA
CCCCTCACAGAGGTCTCCTTCCGCTACCACTGCCAGCTGTACTCCGAGTGGAGAAAGACC
AACCAGAAAGTTCGCCTGAAGATCCGGGAGGCGGACAGCCCCGAGGGCCCCCAGCATTCT
CCACTGGCAGCTGGACTCCTGAAGAAGGTGGCAGAGGAGACACCAGTATGA
Restriction Sites Please inquire     
ACCN NM_001005416
Insert Size 1400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001005416.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001005416.1, NP_001005416.1
RefSeq Size 1224 bp
RefSeq ORF 531 bp
Locus ID 51257
UniProt ID Q9P0N8
Protein Families Druggable Genome, Transmembrane
Gene Summary MARCH2 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH2 reduces surface accumulation of several glycoproteins and appears to regulate early endosome-to-trans-Golgi network (TGN) trafficking (Bartee et al., 2004 [PubMed 14722266]; Nakamura et al., 2005 [PubMed 15689499]).[supplied by OMIM, Mar 2010]
Transcript Variant: This variant (3) has multiple differences in the coding region but maintains the reading frame, compared to variant 4. This variant encodes isoform 2, which is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...