ZWINT (NM_001005413) Human Untagged Clone
CAT#: SC300947
ZWINT (untagged)-Human ZW10 interactor (ZWINT), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HZwint-1; KNTC2AP; SIP30; ZWINT1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC300947 representing NM_001005413.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGGCAGCGGAGACAGAGGCGGAAGCTGCAGCCCTAGAGGTCCTGGCTGAGGTGGCAGGCATCTTG GAACCTGTAGGCCTGCAGGAGGAGGCAGAACTGCCAGCCAAGATCCTGGTTGAGTTTGTGGTGGACTCT CAGAAGAAAGACAAGCTGCTCTGCAGCCAGCTTCAGGTAGCGGATTTCCTGCAGAACATCCTGGCTCAG GAGGACACTGCTAAGGGTCTCGACCCCTTGGCTTCTGAAGACACGAGCCGACAGAAGGCAATTGCAGCT AAGGAACAATGGAAAGAGCTGAAGGCCACCTACAGGGAGCACGTAGAGGCCATCAAAATTGGCCTCACC AAGGCCCTGACTCAGATGGAGGAAGCCCAGAGGAAACGGACACAACTCCGGGAAGCCTTTGAGCAGCTC CAGGCCAAGAAACAAATGGCCATGGAGAAACGCAGAGCAGTCCAGAACCAGTGGCAGCTACAACAGGAG AAGCATCTGCAGCATCTGGCGGAGGTTTCTGCAGAGGGTAAGCTGTTGTTCCCTGAGGCTGAGGCTGAG GCAGAGAATCTTCCAGATGATAAACCCCAGCAGCCGACTCGACCCCAGGAGCAGAGTACAGGAGACACC ATGGGGAGAGACCCTGGTGTGTCCTTCAAGGCTGTTGGTCTACAACCTGCTGGAGATGTAAATTTGCCA TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001005413 |
Insert Size | 693 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001005413.1 |
RefSeq Size | 1546 bp |
RefSeq ORF | 693 bp |
Locus ID | 11130 |
UniProt ID | O95229 |
Protein Families | Druggable Genome |
MW | 25.5 kDa |
Gene Summary | This gene encodes a protein that is clearly involved in kinetochore function although an exact role is not known. It interacts with ZW10, another kinetochore protein, possibly regulating the association between ZW10 and kinetochores. The encoded protein localizes to prophase kinetochores before ZW10 does and it remains detectable on the kinetochore until late anaphase. It has a uniform distribution in the cytoplasm of interphase cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks an alternate in-frame segment compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218540 | ZWINT (Myc-DDK-tagged)-Human ZW10 interactor (ZWINT), transcript variant 3 |
CNY 2,400.00 |
|
RC218540L3 | Lenti ORF clone of Human ZW10 interactor (ZWINT), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218540L4 | Lenti ORF clone of Human ZW10 interactor (ZWINT), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG218540 | ZWINT (tGFP-tagged) - Human ZW10 interactor (ZWINT), transcript variant 3 |
CNY 4,370.00 |