Arp2 (ACTR2) (NM_001005386) Human Untagged Clone

CAT#: SC300935

ACTR2 (untagged)-Human ARP2 actin-related protein 2 homolog (yeast) (ACTR2), transcript variant 1



  "NM_001005386" in other vectors (6)

CNY 3,656.00

CNY 6,460.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ACTR2 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARP2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001005386 edited
ATGGACAGCCAGGGCAGGAAGGTGGTGGTGTGCGACAACGGCACCGGGTTTGTGAAGTGT
GGATATGCAGGCTCTAACTTTCCAGAACACATCTTCCCAGCTTTGGTTGGAAGACCTATT
ATCAGATCAACCACCAAAGTGGGAAACATTGAAATCAAGAATAACAAAAAGATGGATCTT
ATGGTTGGTGATGAGGCAAGTGAATTACGATCAATGTTAGAAGTTAACTACCCTATGGAA
AATGGCATAGTACGAAATTGGGATGACATGAAACACCTGTGGGACTACACATTTGGACCA
GAGAAACTTAATATAGATACCAGAAATTGTAAAATCTTACTCACAGAACCTCCTATGAAC
CCAACCAAAAACAGAGAGAAGATTGTAGAGGTAATGTTTGAAACTTACCAGTTTTCCGGT
GTATATGTAGCCATCCAGGCAGTTCTGACTTTGTACGCTCAAGGTTTATTGACTGGTGTA
GTGGTAGACTCTGGAGATGGTGTGACTCACATTTGCCCAGTATATGAAGGCTTTTCTCTC
CCTCATCTTACCAGGAGACTGGATATTGCTGGGAGGGATATAACTAGATATCTTATCAAG
CTACTTCTGTTGCGAGGATACGCCTTCAACCACTCTGCTGATTTTGAAACGGTTCGCATG
ATTAAAGAAAAACTGTGTTACGTGGGATATAATATTGAGCAAGAGCAGAAACTGGCCTTA
GAAACCACAGTATTAGTTGAATCTTATACACTCCCAGATGGACGTATCATCAAAGTTGGG
GGAGAGAGATTTGAAGCACCAGAAGCTTTATTTCAGCCTCACTTGATCAATGTTGAAGGA
GTTGGTGTTGCTGAATTGCTTTTTAACACAATTCAGGCAGCTGACATTGATACCAGATCT
GAATTCTACAAACACATTGTGCTTTCTGGAGGGTCTACTATGTATCCTGGCCTGCCATCA
CGGTTGGAACGAGAACTTAAACAGCTTTACTTAGAACGAGTTTTGAAGGGTGATGTGGAA
AAACTTTCTAAATTTAAGATCCGCATTGAAGACCCACCCCGCAGAAAGCACATGGTATTC
CTGGGTGGTGCAGTTCTAGCGGATATCATGAAAGACAAAGACAACTTTTGGATGACCCGA
CAAGAGTACCAAGAAAAGGGTGTCCGTGTGCTAGAGAAACTTGGTGTGACTGTTCGATAA
Restriction Sites NotI-NotI     
ACCN NM_001005386
Insert Size 3800 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation ORF was fully sequenced and it matches with NM_001005386.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001005386.1, NP_001005386.1
RefSeq Size 3878 bp
RefSeq ORF 1200 bp
Locus ID 10097
UniProt ID P61160
Protein Families Druggable Genome
Gene Summary The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...