Arp2 (ACTR2) (NM_001005386) Human Untagged Clone
CAT#: SC300935
ACTR2 (untagged)-Human ARP2 actin-related protein 2 homolog (yeast) (ACTR2), transcript variant 1
CNY 3,656.00
CNY 6,460.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARP2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001005386 edited
ATGGACAGCCAGGGCAGGAAGGTGGTGGTGTGCGACAACGGCACCGGGTTTGTGAAGTGT GGATATGCAGGCTCTAACTTTCCAGAACACATCTTCCCAGCTTTGGTTGGAAGACCTATT ATCAGATCAACCACCAAAGTGGGAAACATTGAAATCAAGAATAACAAAAAGATGGATCTT ATGGTTGGTGATGAGGCAAGTGAATTACGATCAATGTTAGAAGTTAACTACCCTATGGAA AATGGCATAGTACGAAATTGGGATGACATGAAACACCTGTGGGACTACACATTTGGACCA GAGAAACTTAATATAGATACCAGAAATTGTAAAATCTTACTCACAGAACCTCCTATGAAC CCAACCAAAAACAGAGAGAAGATTGTAGAGGTAATGTTTGAAACTTACCAGTTTTCCGGT GTATATGTAGCCATCCAGGCAGTTCTGACTTTGTACGCTCAAGGTTTATTGACTGGTGTA GTGGTAGACTCTGGAGATGGTGTGACTCACATTTGCCCAGTATATGAAGGCTTTTCTCTC CCTCATCTTACCAGGAGACTGGATATTGCTGGGAGGGATATAACTAGATATCTTATCAAG CTACTTCTGTTGCGAGGATACGCCTTCAACCACTCTGCTGATTTTGAAACGGTTCGCATG ATTAAAGAAAAACTGTGTTACGTGGGATATAATATTGAGCAAGAGCAGAAACTGGCCTTA GAAACCACAGTATTAGTTGAATCTTATACACTCCCAGATGGACGTATCATCAAAGTTGGG GGAGAGAGATTTGAAGCACCAGAAGCTTTATTTCAGCCTCACTTGATCAATGTTGAAGGA GTTGGTGTTGCTGAATTGCTTTTTAACACAATTCAGGCAGCTGACATTGATACCAGATCT GAATTCTACAAACACATTGTGCTTTCTGGAGGGTCTACTATGTATCCTGGCCTGCCATCA CGGTTGGAACGAGAACTTAAACAGCTTTACTTAGAACGAGTTTTGAAGGGTGATGTGGAA AAACTTTCTAAATTTAAGATCCGCATTGAAGACCCACCCCGCAGAAAGCACATGGTATTC CTGGGTGGTGCAGTTCTAGCGGATATCATGAAAGACAAAGACAACTTTTGGATGACCCGA CAAGAGTACCAAGAAAAGGGTGTCCGTGTGCTAGAGAAACTTGGTGTGACTGTTCGATAA |
Restriction Sites | NotI-NotI |
ACCN | NM_001005386 |
Insert Size | 3800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | ORF was fully sequenced and it matches with NM_001005386.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001005386.1, NP_001005386.1 |
RefSeq Size | 3878 bp |
RefSeq ORF | 1200 bp |
Locus ID | 10097 |
UniProt ID | P61160 |
Protein Families | Druggable Genome |
Gene Summary | The specific function of this gene has not yet been determined; however, the protein it encodes is known to be a major constituent of the ARP2/3 complex. This complex is located at the cell surface and is essential to cell shape and motility through lamellipodial actin assembly and protrusion. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217981 | ACTR2 (Myc-DDK-tagged)-Human ARP2 actin-related protein 2 homolog (yeast) (ACTR2), transcript variant 1 |
CNY 3,656.00 |
|
RC217981L1 | Lenti ORF clone of Human ARP2 actin-related protein 2 homolog (yeast) (ACTR2), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC217981L2 | Lenti ORF clone of Human ARP2 actin-related protein 2 homolog (yeast) (ACTR2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC217981L3 | Lenti ORF clone of Human ARP2 actin-related protein 2 homolog (yeast) (ACTR2), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC217981L4 | Lenti ORF clone of Human ARP2 actin-related protein 2 homolog (yeast) (ACTR2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG217981 | ACTR2 (tGFP-tagged) - Human ARP2 actin-related protein 2 homolog (yeast) (ACTR2), transcript variant 1 |
CNY 5,256.00 |