Nck beta (NCK2) (NM_001004722) Human Untagged Clone
CAT#: SC300760
NCK2 (untagged)-Human NCK adaptor protein 2 (NCK2), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GRB4; NCKbeta |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001004722, the custom clone sequence may differ by one or more nucleotides
ATGACAGAAGAAGTTATTGTGATAGCCAAGTGGGACTACACCGCCCAGCAGGACCAGGAG CTGGACATCAAGAAGAACGAGCGGCTGTGGTTGCTGGACGACTCCAAGACGTGGTGGCGG GTGAGGAACGCGGCCAACAGGACGGGCTATGTACCGTCCAACTACGTGGAGCGGAAGAAC AGCCTGAAGAAGGGCTCCCTCGTGAAGAACCTGAAGGACACACTAGCCCAGCGACTTCTC CGTGTCCCTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001004722 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001004722.1, NP_001004722.1 |
RefSeq Size | 1976 bp |
RefSeq ORF | 252 bp |
Locus ID | 8440 |
Protein Families | Druggable Genome |
Protein Pathways | Axon guidance, ErbB signaling pathway, Pathogenic Escherichia coli infection, T cell receptor signaling pathway |
Gene Summary | This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks an exon, which results in a frameshift, compared to variant 1. The resulting protein (isoform B) is shorter and has a distinct C-terminus, compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223926 | NCK2 (Myc-DDK-tagged)-Human NCK adaptor protein 2 (NCK2), transcript variant 3 |
CNY 3,990.00 |
|
RC223926L3 | Lenti-ORF clone of NCK2 (Myc-DDK-tagged)-Human NCK adaptor protein 2 (NCK2), transcript variant 3 |
CNY 5,890.00 |
|
RC223926L4 | Lenti-ORF clone of NCK2 (mGFP-tagged)-Human NCK adaptor protein 2 (NCK2), transcript variant 3 |
CNY 5,890.00 |
|
RG223926 | NCK2 (tGFP-tagged) - Human NCK adaptor protein 2 (NCK2), transcript variant 3 |
CNY 4,370.00 |