LC3C (MAP1LC3C) (NM_001004343) Human Untagged Clone
CAT#: SC300660
MAP1LC3C (untagged)-Human microtubule-associated protein 1 light chain 3 gamma (MAP1LC3C)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATG8J; LC3C |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001004343 edited
ATGCCGCCTCCACAGAAAATCCCAAGCGTCAGACCCTTCAAGCAGAGGAAAAGCTTGGCA ATCAGACAAGAGGAAGTTGCTGGAATCCGGGCAAAGTTCCCCAACAAAATCCCGGTGGTA GTGGAGCGCTACCCCAGGGAGACGTTCCTGCCCCCGCTGGACAAAACCAAGTTCCTGGTC CCGCAGGAGCTGACCATGACCCAGTTCCTCAGCATCATCCGGAGCCGCATGGTCCTGAGA GCCACGGAAGCCTTTTACTTGCTGGTGAACAACAAGAGCCTGGTCAGCATGAGCGCAACC ATGGCAGAGATCTACAGAGACTACAAGGATGAGGATGGCTTCGTGTACATGACCTACGCC TCCCAGGAGACATTTGGCTGCCTGGAGTCAGCAGCCCCCAGGGATGGGAGCAGCCTTGAG GACAGACCCTGCAATCCTCTCTAG |
Restriction Sites | Please inquire |
ACCN | NM_001004343 |
Insert Size | 440 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001004343.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001004343.1, NP_001004343.1 |
RefSeq Size | 1181 bp |
RefSeq ORF | 444 bp |
Locus ID | 440738 |
UniProt ID | Q9BXW4 |
Gene Summary | Autophagy is a highly regulated bulk degradation process that plays an important role in cellular maintenance and development. MAP1LC3C is an ortholog of the yeast autophagosome protein Atg8 (He et al., 2003 [PubMed 12740394]).[supplied by OMIM, Nov 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220602 | MAP1LC3C (Myc-DDK-tagged)-Human microtubule-associated protein 1 light chain 3 gamma (MAP1LC3C) |
CNY 1,200.00 |
|
RC220602L1 | Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 gamma (MAP1LC3C), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC220602L2 | Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 gamma (MAP1LC3C), mGFP tagged |
CNY 5,890.00 |
|
RC220602L3 | Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 gamma (MAP1LC3C), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC220602L4 | Lenti ORF clone of Human microtubule-associated protein 1 light chain 3 gamma (MAP1LC3C), mGFP tagged |
CNY 3,600.00 |
|
RG220602 | MAP1LC3C (tGFP-tagged) - Human microtubule-associated protein 1 light chain 3 gamma (MAP1LC3C) |
CNY 2,800.00 |