TARP (NM_001003806) Human Untagged Clone

CAT#: SC300557

TARP (untagged)-Human TCR gamma alternate reading frame protein (TARP), nuclear gene encoding mitochondrial protein, transcript variant 2



  "NM_001003806" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TARP Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD3G; TCRG; TCRGC1; TCRGC2; TCRGV
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001003806, the custom clone sequence may differ by one or more nucleotides
ATGAAGACTAACGACACATACATGAAATTTAGCTGGTTAACGGTGCCAGAAAAGTCACTG
GACAAAGAACACAGATGTATCGTCAGACATGAGAATAATAAAAACGGAGTTGATCAAGAA
ATTATCTTTCCTCCAATAAAGACAGATGTCATCACAATGGATCCCAAAGACAATTGTTCA
AAAGATGCAAATGATACACTACTGCTGCAGCTCACAAACACCTCTGCATATTACATGTAC
CTCCTCCTGCTCCTCAAGAGTGTGGTCTATTTTGCCATCATCACCTGCTGTCTGCTTAGA
AGAACGGCTTTCTGCTGCAATGGAGAGAAATCATAA
Restriction Sites Please inquire     
ACCN NM_001003806
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001003806.1, NP_001003806.1
RefSeq Size 1027 bp
RefSeq ORF 336 bp
Locus ID 445347
Protein Families Transmembrane
Gene Summary In some non-lymphoid tissues, the unrearranged T cell receptor gamma (TRG@) locus is expressed. The resulting transcript contains a subset of the TRG@ gene segments and is shorter than TRG@ transcripts expressed in lymphoid tissues. This RefSeq record represents the unrearranged TRG@ locus transcript; the complete TRG@ locus is represented by the genomic RefSeq NG_001336. The transcript represented by this RefSeq has two open reading frames (ORFs) that encode different proteins. The downstream ORF is in the same frame as TRG@ and its protein product is similar to TRG@ proteins. The upstream ORF uses a different reading frame and encodes a novel protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses the downstream ORF. The resulting protein (isoform 2) is similar to but shorter than TRG@ proteins, since this transcript does not include any variable regions.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...