ATP5MF (NM_001003714) Human Untagged Clone
CAT#: SC300531
ATP5J2 (untagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2 (ATP5J2), nuclear gene encoding mitochondrial protein, transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATP5J2; ATP5JL |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001003714, the custom clone sequence may differ by one or more nucleotides
ATGGCGTCAGTTGGTGAGTGTCCGGCCCCAGTACCAGTGAAGGACAAGAAACTTCTGGAG GTCAAACTGGGGGAGCTGCCAAGCTGGATCTTGATGCGGGACTTCAGTCCTAGTGGCATT TTCGGAGCGTTTCAAAGAGAGCACGAGCGGCTCCGCAAATACCACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001003714 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001003714.1, NP_001003714.1 |
RefSeq Size | 395 bp |
RefSeq ORF | 168 bp |
Locus ID | 9551 |
UniProt ID | P56134 |
Protein Families | Transmembrane |
Protein Pathways | Metabolic pathways, Oxidative phosphorylation |
Gene Summary | Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The catalytic portion of mitochondrial ATP synthase consists of five different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the f subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has multiple pseudogenes. Naturally occurring read-through transcription also exists between this gene and the downstream pentatricopeptide repeat domain 1 (PTCD1) gene. [provided by RefSeq, Nov 2010] Transcript Variant: This variant (3) lacks an alternate in-frame exon in the 3' coding region, compared to variant 1. It encodes a shorter isoform (2c) that is missing an internal segment when compared to isoform 2a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219828 | ATP5J2 (Myc-DDK-tagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2 (ATP5J2), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 3,990.00 |
|
RC219828L3 | Lenti-ORF clone of ATP5J2 (Myc-DDK-tagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2 (ATP5J2), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 5,890.00 |
|
RC219828L4 | Lenti-ORF clone of ATP5J2 (mGFP-tagged)-Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2 (ATP5J2), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 5,890.00 |
|
RG219828 | ATP5J2 (tGFP-tagged) - Human ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2 (ATP5J2), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 4,370.00 |