United States
Germany
Japan
United Kingdom
China
NFU1 (NM_001002756) Human Untagged Clone
CAT＃: SC300440
NFU1 (untagged)-Human NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) (NFU1), nuclear gene encoding mitochondrial protein, transcript variant 3
CNY 3,990.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CGI-33; HIRIP; HIRIP5; MMDS1; Nfu; NifU; NIFUC |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001002756, the custom clone sequence may differ by one or more nucleotides
ATGGACTTCTTTGCATCTGGCTTACCCCTGGTTACTGAGGAAACACCTTCAGGAGAAGCA GGATCTGAAGAAGATGATGAAGTTGTGGCAATGATTAAGGAATTGTTAGATACTAGAATA CGGCCAACTGTGCAGGAAGATGGAGGGGATGTAATCTACAAAGGCTTTGAAGATGGCATT GTACAGCTGAAACTCCAGGGTTCTTGTACCAGCTGCCCTAGTTCAATCATTACTCTGAAA AATGGAATTCAGAACATGCTGCAGTTTTATATTCCGGAGGTAGAAGGCGTAGAACAGGTT ATGGATGATGAATCAGATGAAAAAGAAGCAAACTCACCTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001002756 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001002756.1, NP_001002756.1 |
| RefSeq Size | 1045 bp |
| RefSeq ORF | 342 bp |
| Locus ID | 27247 |
| UniProt ID | Q9UMS0 |
| Gene Summary | This gene encodes a protein that is localized to mitochondria and plays a critical role in iron-sulfur cluster biogenesis. The encoded protein assembles and transfers 4Fe-4S clusters to target apoproteins including succinate dehydrogenase and lipoic acid synthase. Mutations in this gene are a cause of multiple mitochondrial dysfunctions syndrome-1, and pseudogenes of this gene are located on the short arms of chromosomes 1 and 3. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (3) lacks an internal exon and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223196 | NFU1 (Myc-DDK-tagged)-Human NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) (NFU1), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 3,990.00 |
|
| RC223196L3 | Lenti-ORF clone of NFU1 (Myc-DDK-tagged)-Human NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) (NFU1), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 5,890.00 |
|
| RC223196L4 | Lenti-ORF clone of NFU1 (mGFP-tagged)-Human NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) (NFU1), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 5,890.00 |
|
| RG223196 | NFU1 (tGFP-tagged) - Human NFU1 iron-sulfur cluster scaffold homolog (S. cerevisiae) (NFU1), nuclear gene encoding mitochondrial protein, transcript variant 3 |
CNY 4,370.00 |
