HSFY1 (HSFY2) (NM_001001877) Human Untagged Clone
CAT#: SC300325
HSFY2 (untagged)-Human heat shock transcription factor, Y linked 2 (HSFY2), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HSF2L; HSFY |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC300325 representing NM_001001877.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCACATGTTTCTTCAGAAACTCAAGATGTTTCCCCCAAAGATGAATTAACTGCTTCAGAAGCCTCC ACTAGGTCTCCATTGTGTGAACACACCTTCCCTGGGGACTCAGACTTACGGTCAATGATTGAAGAACAT GCTTTTCAGGTTTTGTCACAAGGATCCTTGTTAGAAAGTCCAAGTTACACAGTTTGTGTCTCTGAGCCA GATAAAGATGATGATTTTCTTTCTCTGAACTTTCCCAGGAAACTTTGGAAAATAGTGGAAAGTGACCAA TTCAAGTCTATTTCATGGGATGAGAATGGAACTTGCATAGTGATTAATGAAGAACTCTTCAAGAAAGAA ATTTTGGAAACAAAGGCTCCTTACAGAATATTTCAAACTGATGCTATCAAAAGTTTTGTTCGACAGCTC AACCTTTATGGATTTAGTAAAATTCAACAGAATTTTCAAAGATCTGCCTTTCTAGCCACCTTTCTGTCA GAAGAGAAAGAATCGTCTGTCTTAAGCAAGATACGCTTCACCAAAATGAAACTTTCCAGATCTTCAACT TATGAAAACAGGTATTTATGTTGCAACTTACATTTAAAAGATGAGTCGAATTACTCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001001877 |
Insert Size | 612 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001877.1 |
RefSeq Size | 1038 bp |
RefSeq ORF | 612 bp |
Locus ID | 159119 |
UniProt ID | Q96LI6 |
Protein Families | Transcription Factors |
MW | 23.4 kDa |
Gene Summary | This gene encodes a member of the heat shock factor (HSF) family of transcriptional activators for heat shock proteins. This gene is a candidate gene for azoospermia, since it localizes to a region of chromosome Y that is sometimes deleted in infertile males. The genome has two identical copies of this gene within a palindromic region; this record represents the more telomeric copy. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) includes a different exon in the 3' coding region, resulting in a frameshift and earlier termination codon, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus compared to isoform 1. Isoform 2 lacks the HFS-type DNA-binding domain found in isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223109 | HSFY2 (Myc-DDK-tagged)-Human heat shock transcription factor, Y linked 2 (HSFY2), transcript variant 2 |
CNY 2,400.00 |
|
RC223109L3 | Lenti ORF clone of Human heat shock transcription factor, Y linked 2 (HSFY2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC223109L4 | Lenti ORF clone of Human heat shock transcription factor, Y linked 2 (HSFY2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG223109 | HSFY2 (tGFP-tagged) - Human heat shock transcription factor, Y linked 2 (HSFY2), transcript variant 2 |
CNY 4,370.00 |