PDE9A (NM_001001584) Human Untagged Clone
CAT#: SC300237
PDE9A (untagged)-Human phosphodiesterase 9A (PDE9A), transcript variant 19
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HSPDE9A2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001001584, the custom clone sequence may differ by one or more nucleotides
ATGAGGGAGGAGCTGGCGGCCAGAAGCAGCAGGACCAACTGCCCCTGTAAGTACAGTTTT TTGGATAACCACAAGAAGTTGACTCCTCGACGCGATGTTCCCACTTACCCCAAGTACCTG CTCTCTCCAGAGACCATCGAGGCCCTGCGGAAGCCGACCTTTGACGTCTGGCTTTGGGAG CCCAATGAGATGCTGAGCTGCCTGGAGCACATGTACCACGACCTCGGGCTGGTCAGGGAC TTCAGCATCAACCCTGTCACCCTCAGGAGGTGGCTGTTCTGCGTCCACGACAACTACAGA AACAACCCCTTCCACAACTTCCGGCACTGCTTCTGCGTGGCCCAGATGATGTACAGCATG GTCTGGCTCTGCAGTCTCCAGGAGAAGTTCTCACAAACGGATATCCTGATCCTAATGACA GCGGCCATCTGCCACGATCTGGACCATCCCGGCTACAACAACACGTACCAGATCAATGCC CGCACAGAGCTGGCGGTCCGCTACAATGACATCTCACCGCTGGAGAACCACCACTGCGCC GTGGCCTTCCAGATCCTCGCCGAGCCTGAGTGCAACATCTTCTCCAACATCCCACCTGAT GGGTTCAAGCAGATCCGACAGGGAATGATCACATTAATCTTGGCCACTGACATGGCAAGA CATGCAGAAATTATGGATTCTTTCAAAGAGAAAATGGAGAATTTTGACTACAGCAACGAG GAGCACATGACCCTGCTGAAGATGATTTTGATAAAATGCTGTGATATCTCTAACGAGGTC CGTCCAATGGAAGTCGCAGAGCCTTGGGTGGACTGTTTATTAGAGGAATATTTTATGCAG AGCGACCGTGAGAAGTCAGAAGGCCTTCCTGTGGCACCGTTCATGGACCGAGACAAAGTG ACCAAGGCCACAGCCCAGATTGGGTTCATCAAGTTTGTCCTGATCCCAATGTTTGAAACA GTGACCAAGCTCTTCCCCATGGTTGAGGAGATCATGCTGCAGCCACTTTGGGAATCCCGA GATCGCTACGAGGAGCTGAAGCGGATAGATGACGCCATGAAAGAGTTACAGAAGAAGACT GACAGCTTGACGTCTGGGGCCACCGAGAAGTCCAGAGAGAGAAGCAGAGATGTGAAAAAC AGTGAAGGAGACTGTGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001001584 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001001584.1, NP_001001584.1 |
RefSeq Size | 1852 bp |
RefSeq ORF | 1161 bp |
Locus ID | 5152 |
UniProt ID | O76083 |
Protein Families | Druggable Genome |
Protein Pathways | Progesterone-mediated oocyte maturation, Purine metabolism |
Gene Summary | The protein encoded by this gene catalyzes the hydrolysis of cAMP and cGMP to their corresponding monophosphates. The encoded protein plays a role in signal transduction by regulating the intracellular concentration of these cyclic nucleotides. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (19) contains an alternate exon and lacks three others compared to variant 1. The resulting predicted isoform (g) has a shorter N-terminus compared to isoform a. Variants 7, 8, 14, 19, and 20 all encode isoform g. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217256 | PDE9A (Myc-DDK-tagged)-Human phosphodiesterase 9A (PDE9A), transcript variant 19 |
CNY 3,990.00 |
|
RC217256L3 | Lenti-ORF clone of PDE9A (Myc-DDK-tagged)-Human phosphodiesterase 9A (PDE9A), transcript variant 19 |
CNY 5,890.00 |
|
RC217256L4 | Lenti-ORF clone of PDE9A (mGFP-tagged)-Human phosphodiesterase 9A (PDE9A), transcript variant 19 |
CNY 5,890.00 |
|
RG217256 | PDE9A (tGFP-tagged) - Human phosphodiesterase 9A (PDE9A), transcript variant 19 |
CNY 4,370.00 |