NDUFV3 (NM_001001503) Human Untagged Clone
CAT#: SC300203
NDUFV3 (untagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CI-9KD; CI-10k |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001001503, the custom clone sequence may differ by one or more nucleotides
ATGGCTGCCCCGTGTTTGCTGCGGCAAGGACGAGCCGGGGCGCTGAAGACTATGCTCCAG GAAGCCCAGGTGTTTCGAGGACTTGCTTCTACGGTTTCTTTGTCTGCGGAATCAGGGAAG AGTGAAAAGGGTCAGCCACAGAATTCCAAGAAGCAAAGTCCACCAAAAAAGCCAGCCCCA GTGCCTGCTGAGCCGTTTGACAACACTACCTACAAGAACCTGCAGCATCATGACTACAGC ACGTACACCTTCTTAGACCTCAACCTCGAACTCTCAAAATTCAGGATGCCTCAGCCCTCC TCAGGCCGGGAGTCACCTCGACACTGA |
Restriction Sites | Please inquire |
ACCN | NM_001001503 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001001503.1, NP_001001503.1 |
RefSeq Size | 1056 bp |
RefSeq ORF | 327 bp |
Locus ID | 4731 |
UniProt ID | P56181 |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | The protein encoded by this gene is one of at least forty-one subunits that make up the NADH-ubiquinone oxidoreductase complex. This complex is part of the mitochondrial respiratory chain and serves to catalyze the rotenone-sensitive oxidation of NADH and the reduction of ubiquinone. The encoded protein is one of three proteins found in the flavoprotein fraction of the complex. The specific function of the encoded protein is unknown. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215334 | NDUFV3 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,990.00 |
|
RC215334L3 | Lenti-ORF clone of NDUFV3 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RC215334L4 | Lenti-ORF clone of NDUFV3 (mGFP-tagged)-Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RG215334 | NDUFV3 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa (NDUFV3), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |