United States
Germany
Japan
United Kingdom
China
BCL2 (NM_000657) Human Untagged Clone
CAT＃: SC300115
BCL2 (untagged)-Human B-cell CLL/lymphoma 2 (BCL2), nuclear gene encoding mitochondrial protein, transcript variant beta
CNY 3,600.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Bcl-2; PPP1R50 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_000657 edited
ATGGCGCACGCTGGGAGAACGGGGTACGATAACCGGGAGATAGTGATGAAGTACATCCAT TATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGCGCCCCCG GGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCATCCAGCC GCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCCCGGCGCC GCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTCCGCCAGGCC GGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCCAGCCAGCTGCAC CTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGAC GGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAG AGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTAC CTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGTAGGTGCACTTGGT GATGTGAGTCTGGGCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_000657 |
| Insert Size | 4700 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_000657.2. This SNP doesn't change amino acid. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_000657.2, NP_000648.2 |
| RefSeq Size | 1207 bp |
| RefSeq ORF | 618 bp |
| Locus ID | 596 |
| UniProt ID | P10415 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Stem cell - Pluripotency, Transmembrane |
| Protein Pathways | Amyotrophic lateral sclerosis (ALS), Apoptosis, Colorectal cancer, Focal adhesion, Neurotrophin signaling pathway, Pathways in cancer, Prostate cancer, Small cell lung cancer |
| Gene Summary | This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (beta) differs in the 3' UTR and coding region compared to variant alpha. The resulting isoform (beta) is shorter and has a distinct C-terminus compared to isoform alpha. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212055 | BCL2 (Myc-DDK-tagged)-Human B-cell CLL/lymphoma 2 (BCL2), nuclear gene encoding mitochondrial protein, transcript variant beta |
CNY 3,600.00 |
|
| RC212055L1 | Lenti ORF clone of Human B-cell CLL/lymphoma 2 (BCL2), nuclear gene encoding mitochondrial protein, transcript variant beta, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC212055L2 | Lenti ORF clone of Human B-cell CLL/lymphoma 2 (BCL2), nuclear gene encoding mitochondrial protein, transcript variant beta, mGFP tagged |
CNY 6,000.00 |
|
| RC212055L3 | Lenti ORF clone of Human B-cell CLL/lymphoma 2 (BCL2), nuclear gene encoding mitochondrial protein, transcript variant beta, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC212055L4 | Lenti ORF clone of Human B-cell CLL/lymphoma 2 (BCL2), nuclear gene encoding mitochondrial protein, transcript variant beta, mGFP tagged |
CNY 6,000.00 |
|
| RG212055 | BCL2 (tGFP-tagged) - Human B-cell CLL/lymphoma 2 (BCL2), nuclear gene encoding mitochondrial protein, transcript variant beta |
CNY 5,200.00 |
