FSH beta (FSHB) (NM_000510) Human Untagged Clone

CAT#: SC300085

FSHB (untagged)-Human follicle stimulating hormone, beta polypeptide (FSHB), transcript variant 1



  "NM_000510" in other vectors (6)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-FSHB (FSH beta) mouse monoclonal antibody, clone OTI3A9 (formerly 3A9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HH24
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_000510 edited
ATGAAGACACTCCAGTTTTTCTTCCTTTTCTGTTGCTGGAAAGCAATCTGCTGCAATAGC
TGTGAGCTGACCAACATCACCATTGCAATAGAGAAAGAAGAATGTCGTTTCTGCATAAGC
ATCAACACCACTTGGTGTGCTGGCTACTGCTACACCAGGGATCTGGTGTATAAGGACCCA
GCCAGGCCCAAAATCCAGAAAACATGTACCTTCAAGGAACTGGTATACGAAACAGTGAGA
GTGCCCGGCTGTGCTCACCATGCAGATTCCTTGTATACATACCCAGTGGCCACCCAGTGT
CACTGTGGCAAGTGTGACAGCGACAGCACTGATTGTACTGTGCGAGGCCTGGGGCCCAGC
TACTGCTCCTTTGGTGAAATGAAAGAATAA
Restriction Sites Please inquire     
ACCN NM_000510
Insert Size 400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation It is not a varient.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_000510.2, NP_000501.1
RefSeq Size 1936 bp
RefSeq ORF 390 bp
Locus ID 2488
UniProt ID P01225
Protein Families Druggable Genome, Secreted Protein
Protein Pathways GnRH signaling pathway, Neuroactive ligand-receptor interaction
Gene Summary The pituitary glycoprotein hormone family includes follicle-stimulating hormone, luteinizing hormone, chorionic gonadotropin, and thyroid-stimulating hormone. All of these glycoproteins consist of an identical alpha subunit and a hormone-specific beta subunit. This gene encodes the beta subunit of follicle-stimulating hormone. In conjunction with luteinizing hormone, follicle-stimulating hormone induces egg and sperm production. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...