FSH beta (FSHB) (NM_000510) Human Untagged Clone
CAT#: SC300085
FSHB (untagged)-Human follicle stimulating hormone, beta polypeptide (FSHB), transcript variant 1
CNY 1,200.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HH24 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_000510 edited
ATGAAGACACTCCAGTTTTTCTTCCTTTTCTGTTGCTGGAAAGCAATCTGCTGCAATAGC TGTGAGCTGACCAACATCACCATTGCAATAGAGAAAGAAGAATGTCGTTTCTGCATAAGC ATCAACACCACTTGGTGTGCTGGCTACTGCTACACCAGGGATCTGGTGTATAAGGACCCA GCCAGGCCCAAAATCCAGAAAACATGTACCTTCAAGGAACTGGTATACGAAACAGTGAGA GTGCCCGGCTGTGCTCACCATGCAGATTCCTTGTATACATACCCAGTGGCCACCCAGTGT CACTGTGGCAAGTGTGACAGCGACAGCACTGATTGTACTGTGCGAGGCCTGGGGCCCAGC TACTGCTCCTTTGGTGAAATGAAAGAATAA |
Restriction Sites | Please inquire |
ACCN | NM_000510 |
Insert Size | 400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | It is not a varient. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_000510.2, NP_000501.1 |
RefSeq Size | 1936 bp |
RefSeq ORF | 390 bp |
Locus ID | 2488 |
UniProt ID | P01225 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | GnRH signaling pathway, Neuroactive ligand-receptor interaction |
Gene Summary | The pituitary glycoprotein hormone family includes follicle-stimulating hormone, luteinizing hormone, chorionic gonadotropin, and thyroid-stimulating hormone. All of these glycoproteins consist of an identical alpha subunit and a hormone-specific beta subunit. This gene encodes the beta subunit of follicle-stimulating hormone. In conjunction with luteinizing hormone, follicle-stimulating hormone induces egg and sperm production. Alternative splicing results in two transcript variants encoding the same protein. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222666 | FSHB (Myc-DDK-tagged)-Human follicle stimulating hormone, beta polypeptide (FSHB), transcript variant 1 |
CNY 1,200.00 |
|
RC222666L1 | Lenti ORF clone of Human follicle stimulating hormone, beta polypeptide (FSHB), transcript variant 1, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC222666L2 | Lenti ORF clone of Human follicle stimulating hormone, beta polypeptide (FSHB), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC222666L3 | Lenti ORF clone of Human follicle stimulating hormone, beta polypeptide (FSHB), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222666L4 | Lenti ORF clone of Human follicle stimulating hormone, beta polypeptide (FSHB), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG222666 | FSHB (tGFP-tagged) - Human follicle stimulating hormone, beta polypeptide (FSHB), transcript variant 1 |
CNY 2,800.00 |
其它FSH beta产品