United States
Germany
Japan
United Kingdom
China
HTN3 (NM_000200) Human Untagged Clone
CAT＃: SC300023
HTN3 (untagged)-Human histatin 3 (HTN3)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HIS2; HTN2; HTN5; PB |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC300023 representing NM_000200.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGTTTTTTGTTTTTGCTTTAATCTTGGCTCTCATGCTTTCCATGACTGGAGCTGATTCACATGCA AAGAGACATCATGGGTATAAAAGAAAATTCCATGAAAAGCATCATTCACATCGAGGCTATAGATCAAAT TATCTGTATGACAATTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_000200 |
| Insert Size | 156 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_000200.2 |
| RefSeq Size | 601 bp |
| RefSeq ORF | 156 bp |
| Locus ID | 3347 |
| UniProt ID | P15516 |
| Protein Families | Secreted Protein |
| MW | 6.1 kDa |
| Gene Summary | This gene encodes a member of the histatin family of small, histidine-rich, cationic proteins. They function as antimicrobial peptides and are important components of the innate immune system. Histatins are found in saliva and exhibit antibacterial, antifungal activities and function in wound healing. [provided by RefSeq, Sep 2014] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203123 | HTN3 (Myc-DDK-tagged)-Human histatin 3 (HTN3) |
CNY 1,200.00 |
|
| RC203123L3 | Lenti ORF clone of Human histatin 3 (HTN3), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC203123L4 | Lenti ORF clone of Human histatin 3 (HTN3), mGFP tagged |
CNY 5,890.00 |
|
| RG203123 | HTN3 (tGFP-tagged) - Human histatin 3 (HTN3) |
CNY 2,800.00 |
