United States
Germany
Japan
United Kingdom
China
STAT1 (NM_139266) Human Untagged Clone
CAT＃: SC128145
STAT1 (untagged)-Human signal transducer and activator of transcription 1, 91kDa (STAT1), transcript variant beta
CNY 7,832.00
| Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CANDF7; IMD31A; IMD31B; IMD31C; ISGF-3; STAT91 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_139266, the custom clone sequence may differ by one or more nucleotides
ATGTCTCAGTGGTACGAACTTCAGCAGCTTGACTCAAAATTCCTGGAGCAGGTTCACCAGCTTTATGATG ACAGTTTTCCCATGGAAATCAGACAGTACCTGGCACAGTGGTTAGAAAAGCAAGACTGGGAGCACGCTGC CAATGATGTTTCATTTGCCACCATCCGTTTTCATGACCTCCTGTCACAGCTGGATGATCAATATAGTCGC TTTTCTTTGGAGAATAACTTCTTGCTACAGCATAACATAAGGAAAAGCAAGCGTAATCTTCAGGATAATT TTCAGGAAGACCCAATCCAGATGTCTATGATCATTTACAGCTGTCTGAAGGAAGAAAGGAAAATTCTGGA AAACGCCCAGAGATTTAATCAGGCTCAGTCGGGGAATATTCAGAGCACAGTGATGTTAGACAAACAGAAA GAGCTTGACAGTAAAGTCAGAAATGTGAAGGACAAGGTTATGTGTATAGAGCATGAAATCAAGAGCCTGG AAGATTTACAAGATGAATATGACTTCAAATGCAAAACCTTGCAGAACAGAGAACACGAGACCAATGGTGT GGCAAAGAGTGATCAGAAACAAGAACAGCTGTTACTCAAGAAGATGTATTTAATGCTTGACAATAAGAGA AAGGAAGTAGTTCACAAAATAATAGAGTTGCTGAATGTCACTGAACTTACCCAGAATGCCCTGATTAATG ATGAACTAGTGGAGTGGAAGCGGAGACAGCAGAGCGCCTGTATTGGGGGGCCGCCCAATGCTTGCTTGGA TCAGCTGCAGAACTGGTTCACTATAGTTGCGGAGAGTCTGCAGCAAGTTCGGCAGCAGCTTAAAAAGTTG GAGGAATTGGAACAGAAATACACCTACGAACATGACCCTATCACAAAAAACAAACAAGTGTTATGGGACC GCACCTTCAGTCTTTTCCAGCAGCTCATTCAGAGCTCGTTTGTGGTGGAAAGACAGCCCTGCATGCCAAC GCACCCTCAGAGGCCGCTGGTCTTGAAGACAGGGGTCCAGTTCACTGTGAAGTTGAGACTGTTGGTGAAA TTGCAAGAGCTGAATTATAATTTGAAAGTCAAAGTCTTATTTGATAAAGATGTGAATGAGAGAAATACAG TAAAAGGATTTAGGAAGTTCAACATTTTGGGCACGCACACAAAAGTGATGAACATGGAGGAGTCCACCAA TGGCAGTCTGGCGGCTGAATTTCGGCACCTGCAATTGAAAGAACAGAAAAATGCTGGCACCAGAACGAAT GAGGGTCCTCTCATCGTTACTGAAGAGCTTCACTCCCTTAGTTTTGAAACCCAATTGTGCCAGCCTGGTT TGGTAATTGACCTCGAGACGACCTCTCTGCCCGTTGTGGTGATCTCCAACGTCAGCCAGCTCCCGAGCGG TTGGGCCTCCATCCTTTGGTACAACATGCTGGTGGCGGAACCCAGGAATCTGTCCTTCTTCCTGACTCCA CCATGTGCACGATGGGCTCAGCTTTCAGAAGTGCTGAGTTGGCAGTTTTCTTCTGTCACCAAAAGAGGTC TCAATGTGGACCAGCTGAACATGTTGGGAGAGAAGCTTCTTGGTCCTAACGCCAGCCCCGATGGTCTCAT TCCGTGGACGAGGTTTTGTAAGGAAAATATAAATGATAAAAATTTTCCCTTCTGGCTTTGGATTGAAAGC ATCCTAGAACTCATTAAAAAACACCTGCTCCCTCTCTGGAATGATGGGTGCATCATGGGCTTCATCAGCA AGGAGCGAGAGCGTGCCCTGTTGAAGGACCAGCAGCCGGGGACCTTCCTGCTGCGGTTCAGTGAGAGCTC CCGGGAAGGGGCCATCACATTCACATGGGTGGAGCGGTCCCAGAACGGAGGCGAACCTGACTTCCATGCG GTTGAACCCTACACGAAGAAAGAACTTTCTGCTGTTACTTTCCCTGACATCATTCGCAATTACAAAGTCA TGGCTGCTGAGAATATTCCTGAGAATCCCCTGAAGTATCTGTATCCAAATATTGACAAAGACCATGCCTT TGGAAAGTATTACTCCAGGCCAAAGGAAGCACCAGAGCCAATGGAACTTGATGGCCCTAAAGGAACTGGA TATATCAAGACTGAGTTGATTTCTGTGTCTGAAGTGTAA |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | NotI-NotI |
| ACCN | NM_139266 |
| Insert Size | 4500 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_139266.1, NP_644671.1 |
| RefSeq Size | 2762 bp |
| RefSeq ORF | 2139 bp |
| Locus ID | 6772 |
| UniProt ID | P42224 |
| Domains | SH2, STAT |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | Chemokine signaling pathway, Jak-STAT signaling pathway, Pancreatic cancer, Pathways in cancer, Toll-like receptor signaling pathway |
| Gene Summary | The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. The protein encoded by this gene can be activated by various ligands including interferon-alpha, interferon-gamma, EGF, PDGF and IL6. This protein mediates the expression of a variety of genes, which is thought to be important for cell viability in response to different cell stimuli and pathogens. The protein plays an important role in immune responses to viral, fungal and mycobacterial pathogens. Mutations in this gene are associated with Immunodeficiency 31B, 31A, and 31C. [provided by RefSeq, Jun 2020] Transcript Variant: This variant (beta) is different in its 3' coding region and UTR compared to variant alpha. It encodes a protein (isoform beta) with a shorter C-terminus, when compared to isoform alpha. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Signal transducer and activator of transcription 1 (Stat1) maintains basal mRNA expression of pro-survival stat3-target genes in glioma C6 cells.
,null,
Journal of cellular biochemistry
,PubMed ID 21815198
[STAT1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201075 | STAT1 (Myc-DDK-tagged)-Human signal transducer and activator of transcription 1, 91kDa (STAT1), transcript variant beta |
CNY 7,824.00 |
|
| RC201075L1 | Lenti ORF clone of Human signal transducer and activator of transcription 1, 91kDa (STAT1), transcript variant beta, Myc-DDK-tagged |
CNY 10,224.00 |
|
| RC201075L2 | Lenti ORF clone of Human signal transducer and activator of transcription 1, 91kDa (STAT1), transcript variant beta, mGFP tagged |
CNY 10,224.00 |
|
| RC201075L3 | Lenti ORF clone of Human signal transducer and activator of transcription 1, 91kDa (STAT1), transcript variant beta, Myc-DDK-tagged |
CNY 7,700.00 |
|
| RC201075L4 | Lenti ORF clone of Human signal transducer and activator of transcription 1, 91kDa (STAT1), transcript variant beta, mGFP tagged |
CNY 10,224.00 |
|
| RG201075 | STAT1 (tGFP-tagged) - Human signal transducer and activator of transcription 1, 91kDa (STAT1), transcript variant beta |
CNY 9,424.00 |
