PPP2R5C (NM_178587) Human Untagged Clone
CAT#: SC127991
PPP2R5C (untagged)-Human protein phosphatase 2, regulatory subunit B', gamma (PPP2R5C), transcript variant 3
CNY 4,024.00
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B56G; B56gamma; PR61G |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_178587, the custom clone sequence may differ by one or more nucleotides
ATGTTGACATGTAATAAAGCGGGCAGCAGGATGGTGGTGGATGCGGCCAACTCCAATGGGCCTTTCCAGC CCGTGGTCCTTCTCCATATTCGAGATGTTCCTCCTGCTGATCAAGAGAAGCTTTTTATCCAGAAGTTACG TCAGTGTTGCGTCCTCTTTGACTTTGTTTCTGATCCACTAAGTGACCTAAAGTGGAAGGAAGTAAAACGA GCTGCTTTAAGTGAAATGGTAGAATATATCACCCATAATCGGAATGTGATCACAGAGCCTATTTACCCAG AAGTAGTCCATATGTTTGCAGTTAACATGTTTCGAACATTACCACCTTCCTCCAATCCTACGGGAGCGGA ATTTGACCCGGAGGAAGATGAACCAACGTTAGAAGCAGCCTGGCCTCATCTACAGCTTGTTTATGAATTT TTCTTAAGATTTTTAGAGTCTCCAGATTTCCAACCTAATATAGCGAAGAAATATATTGATCAGAAGTTTG TATTGCAGCTTTTAGAGCTCTTTGACAGTGAAGATCCTCGGGAGAGAGATTTTCTTAAAACCACCCTTCA CAGAATCTATGGGAAATTCCTAGGCTTGAGAGCTTACATCAGAAAACAGATAAATAATATATTTTATAGG TTTATTTATGAAACAGAGCATCATAATGGCATAGCAGAGTTACTGGAAATATTGGGAAGTATAATTAATG GATTTGCCTTACCACTAAAAGAAGAGCACAAGATTTTCTTATTGAAGGTGTTACTACCTTTGCACAAAGT GAAATCTCTGAGTGTCTACCATCCCCAGCTGGCATACTGTGTAGTGCAGTTTTTAGAAAAGGACAGCACC CTCACGGAACCAGTGGTGATGGCACTTCTCAAATACTGGCCAAAGACTCACAGTCCAAAAGAAGTAATGT TCTTAAACGAATTAGAAGAGATTTTAGATGTCATTGAACCATCAGAATTTGTGAAGATCATGGAACCCCT CTTCCGGCAGTTGGCCAAATGTGTCTCCAGCCCACACTTCCAGGTGGCAGAGCGAGCTCTCTATTACTGG AATAATGAATACATCATGAGTTTAATCAGTGACAACGCAGCGAAGATTCTGCCCATCATGTTTCCTTCCT TGTACCGCAACTCAAAGACCCATTGGAACAAGACAATACATGGCTTGATATACAACGCCCTGAAGCTCTT CATGGAGATGAACCAAAAGCTATTTGATGACTGTACACAACAGTTCAAAGCAGAGAAACTAAAAGAGAAG CTAAAAATGAAAGAACGGGAAGAAGCATGGGTTAAAATAGAAAATCTAGCCAAAGCCAATCCCCAGGTAC TAAAAAAGAGAATAACATGA |
Restriction Sites | NotI-NotI |
ACCN | NM_178587 |
Insert Size | 6000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_178587.1, NP_848702.1 |
RefSeq Size | 1586 bp |
RefSeq ORF | 1350 bp |
Locus ID | 5527 |
UniProt ID | Q13362 |
Protein Families | Druggable Genome, Phosphatase |
Protein Pathways | Oocyte meiosis, Wnt signaling pathway |
Gene Summary | The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) differs in the 3' UTR and the 3' coding region, compared to variant 1. It encodes an isoform (c), also known as gamma 1, that is shorter and has a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217361 | PPP2R5C (Myc-DDK-tagged)-Human protein phosphatase 2, regulatory subunit B', gamma (PPP2R5C), transcript variant 3 |
CNY 3,990.00 |
|
RC217361L3 | Lenti-ORF clone of PPP2R5C (Myc-DDK-tagged)-Human protein phosphatase 2, regulatory subunit B', gamma (PPP2R5C), transcript variant 3 |
CNY 5,890.00 |
|
RC217361L4 | Lenti-ORF clone of PPP2R5C (mGFP-tagged)-Human protein phosphatase 2, regulatory subunit B', gamma (PPP2R5C), transcript variant 3 |
CNY 5,890.00 |
|
RG217361 | PPP2R5C (tGFP-tagged) - Human protein phosphatase 2, regulatory subunit B', gamma (PPP2R5C), transcript variant 3 |
CNY 5,624.00 |
其它PPP2R5C产品