PPP2R5C (NM_178587) Human Untagged Clone

CAT#: SC127991

PPP2R5C (untagged)-Human protein phosphatase 2, regulatory subunit B', gamma (PPP2R5C), transcript variant 3



  "NM_178587" in other vectors (4)

CNY 4,024.00

CNY 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-PPP2R5C Antibody - middle region
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms B56G; B56gamma; PR61G
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_178587, the custom clone sequence may differ by one or more nucleotides


ATGTTGACATGTAATAAAGCGGGCAGCAGGATGGTGGTGGATGCGGCCAACTCCAATGGGCCTTTCCAGC
CCGTGGTCCTTCTCCATATTCGAGATGTTCCTCCTGCTGATCAAGAGAAGCTTTTTATCCAGAAGTTACG
TCAGTGTTGCGTCCTCTTTGACTTTGTTTCTGATCCACTAAGTGACCTAAAGTGGAAGGAAGTAAAACGA
GCTGCTTTAAGTGAAATGGTAGAATATATCACCCATAATCGGAATGTGATCACAGAGCCTATTTACCCAG
AAGTAGTCCATATGTTTGCAGTTAACATGTTTCGAACATTACCACCTTCCTCCAATCCTACGGGAGCGGA
ATTTGACCCGGAGGAAGATGAACCAACGTTAGAAGCAGCCTGGCCTCATCTACAGCTTGTTTATGAATTT
TTCTTAAGATTTTTAGAGTCTCCAGATTTCCAACCTAATATAGCGAAGAAATATATTGATCAGAAGTTTG
TATTGCAGCTTTTAGAGCTCTTTGACAGTGAAGATCCTCGGGAGAGAGATTTTCTTAAAACCACCCTTCA
CAGAATCTATGGGAAATTCCTAGGCTTGAGAGCTTACATCAGAAAACAGATAAATAATATATTTTATAGG
TTTATTTATGAAACAGAGCATCATAATGGCATAGCAGAGTTACTGGAAATATTGGGAAGTATAATTAATG
GATTTGCCTTACCACTAAAAGAAGAGCACAAGATTTTCTTATTGAAGGTGTTACTACCTTTGCACAAAGT
GAAATCTCTGAGTGTCTACCATCCCCAGCTGGCATACTGTGTAGTGCAGTTTTTAGAAAAGGACAGCACC
CTCACGGAACCAGTGGTGATGGCACTTCTCAAATACTGGCCAAAGACTCACAGTCCAAAAGAAGTAATGT
TCTTAAACGAATTAGAAGAGATTTTAGATGTCATTGAACCATCAGAATTTGTGAAGATCATGGAACCCCT
CTTCCGGCAGTTGGCCAAATGTGTCTCCAGCCCACACTTCCAGGTGGCAGAGCGAGCTCTCTATTACTGG
AATAATGAATACATCATGAGTTTAATCAGTGACAACGCAGCGAAGATTCTGCCCATCATGTTTCCTTCCT
TGTACCGCAACTCAAAGACCCATTGGAACAAGACAATACATGGCTTGATATACAACGCCCTGAAGCTCTT
CATGGAGATGAACCAAAAGCTATTTGATGACTGTACACAACAGTTCAAAGCAGAGAAACTAAAAGAGAAG
CTAAAAATGAAAGAACGGGAAGAAGCATGGGTTAAAATAGAAAATCTAGCCAAAGCCAATCCCCAGGTAC
TAAAAAAGAGAATAACATGA


Restriction Sites NotI-NotI     
ACCN NM_178587
Insert Size 6000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_178587.1, NP_848702.1
RefSeq Size 1586 bp
RefSeq ORF 1350 bp
Locus ID 5527
UniProt ID Q13362
Protein Families Druggable Genome, Phosphatase
Protein Pathways Oocyte meiosis, Wnt signaling pathway
Gene Summary The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a gamma isoform of the regulatory subunit B56 subfamily. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 3' UTR and the 3' coding region, compared to variant 1. It encodes an isoform (c), also known as gamma 1, that is shorter and has a distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...