ZMPSTE24 (NM_005857) Human Untagged Clone
CAT#: SC127925
ZMPSTE24 (untagged)-Human zinc metallopeptidase (STE24 homolog, S. cerevisiae) (ZMPSTE24)
CNY 11,016.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FACE-1; FACE1; HGPS; PRO1; STE24; Ste24p |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_005857, the custom clone sequence may differ by one or more nucleotides
ATGGGGATGTGGGCATCGCTGGACGCTTTGTGGGAGATGCCGGCCGAGAAGCGTATCTTCGGGGCCGTGC TGCTCTTTTCCTGGACAGTGTATCTTTGGGAGACCTTCCTAGCACAGCGGCAGAGAAGGATATATAAAAC AACAACTCATGTACCACCGGAGTTAGGACAGATCATGGATTCTGAAACATTTGAGAAATCTCGACTCTAT CAACTGGATAAAAGCACTTTCAGCTTCTGGTCAGGACTCTATTCAGAGACTGAAGGCACTCTTATTCTTC TCTTTGGAGGAATACCTTATCTCTGGAGACTTTCTGGACGGTTCTGTGGTTATGCTGGCTTTGGACCAGA ATATGAGATCACTCAGTCCCTGGTGTTTCTGCTGTTGGCTACACTTTTCAGTGCATTGACTGGTTTGCCA TGGAGTCTTTATAATACTTTTGTGATAGAAGAAAAACATGGCTTCAATCAACAGACTTTGGGGTTCTTCA TGAAAGATGCAATCAAGAAATTTGTTGTGACTCAGTGTATTTTGTTGCCTGTGTCTTCACTTCTACTTTA CATTATTAAAATTGGGGGTGACTATTTTTTTATTTATGCCTGGCTGTTCACATTAGTTGTGTCTCTGGTT CTTGTCACAATCTATGCTGATTATATTGCCCCTTTATTTGACAAATTCACACCTCTGCCTGAGGGAAAGC TTAAAGAAGAAATTGAAGTAATGGCAAAGAGTATTGACTTTCCTTTGACGAAGGTGTATGTTGTGGAAGG ATCTAAACGCTCTTCCCACAGCAATGCTTATTTTTATGGCTTCTTCAAGAACAAGCGAATAGTTTTGTTT GACACTCTACTAGAAGAGTACTCTGTACTAAACAAAGACATCCAGGAGGATTCTGGCATGGAACCCCGCA ATGAGGAAGAAGGGAACAGTGAAGAAATAAAAGCTAAAGTTAAAAATAAGAAACAAGGATGTAAAAATGA GGAGGTACTCGCTGTACTAGGCCATGAACTGGGGCACTGGAAGTTGGGACATACAGTCAAAAATATCATT ATTAGCCAGATGAATTCTTTCCTGTGTTTTTTTTTATTTGCTGTATTAATTGGTCGAAAGGAGCTTTTTG CTGCATTTGGTTTTTATGATAGCCAACCCACTCTTATTGGACTATTGATCATCTTCCAGTTTATTTTTTC ACCTTACAATGAGGTTCTTTCTTTTTGCCTAACAGTCCTAAGCCGCAGATTTGAGTTTCAAGCTGATGCA TTTGCCAAGAAACTTGGGAAGGCTAAAGACTTATATTCTGCTTTAATCAAACTTAACAAAGATAACTTGG GATTCCCTGTTTCTGACTGGTTGTTCTCAATGTGGCATTATTCTCATCCTCCACTGCTAGAGAGACTTCA AGCTTTGAAAACTATGAAGCAACACTGA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | NotI-NotI |
ACCN | NM_005857 |
Insert Size | 2820 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone may be unstable or toxic at high copy number in common E. coli strain. We recommend using a lower copy number E. coli strain, such as CopyCutter strain (http://www.epibio.com/item.asp?ID=435) for transformation and plasmid preparation. Please be aware that the DNA yield could be low. Additional aliquots of this clone can be ordered from OriGene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005857.2, NP_005848.2 |
RefSeq Size | 3165 bp |
RefSeq ORF | 3165 bp |
Locus ID | 10269 |
UniProt ID | O75844 |
Domains | Peptidase_M48 |
Protein Families | Druggable Genome, Protease, Transmembrane |
Gene Summary | This gene encodes a member of the peptidase M48A family. The encoded protein is a zinc metalloproteinase involved in the two step post-translational proteolytic cleavage of carboxy terminal residues of farnesylated prelamin A to form mature lamin A. Mutations in this gene have been associated with mandibuloacral dysplasia and restrictive dermopathy. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206035 | ZMPSTE24 (Myc-DDK-tagged)-Human zinc metallopeptidase (STE24 homolog, S. cerevisiae) (ZMPSTE24) |
CNY 5,488.00 |
|
RC206035L1 | Lenti ORF clone of Human zinc metallopeptidase (STE24 homolog, S. cerevisiae) (ZMPSTE24), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC206035L2 | Lenti ORF clone of Human zinc metallopeptidase (STE24 homolog, S. cerevisiae) (ZMPSTE24), mGFP tagged |
CNY 5,890.00 |
|
RC206035L3 | Lenti ORF clone of Human zinc metallopeptidase (STE24 homolog, S. cerevisiae) (ZMPSTE24), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC206035L4 | Lenti ORF clone of Human zinc metallopeptidase (STE24 homolog, S. cerevisiae) (ZMPSTE24), mGFP tagged |
CNY 5,890.00 |
|
RG206035 | ZMPSTE24 (tGFP-tagged) - Human zinc metallopeptidase (STE24 homolog, S. cerevisiae) (ZMPSTE24) |
CNY 7,088.00 |
其它ZMPSTE24产品