Neuronatin (NNAT) (NM_181689) Human Untagged Clone

CAT#: SC127295

NNAT (untagged)-Human neuronatin (NNAT), transcript variant 2



  "NM_181689" in other vectors (6)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-NNAT Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms Peg5
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_181689, the custom clone sequence may differ by one or more nucleotides


ATGGCGGCAGTGGCGGCGGCCTCGGCTGAACTGCTCATCATCGGCTGGTACATCTTCCGCGTGCTGCTGC
AGGTGTTCAGGTACTCCCTGCAGAAGCTGGCATACACGGTGTCGCGGACCGGGCGGCAGGTGTTGGGGGA
GCGCAGGCAGCGAGCCCCCAACTGA


>OriGene 5' read for NM_181689 unedited
TAATACGACTCACTATAGGGCGGCCGCGAATTCGGCACGAGGGTATCATCAGGTGCTCCT
GTGCATCTCGGCCAGCACGGGAGCCAGTGCCGCGCAGGAATGTGGGGTCCCCTGTGTTCC
CTCGCCAGAGGAGCACTTGGCAAGGTCAGTGAGGGGCCAGTAGACCCCCGGAGAAGCAGT
ACCGACAATGACGAAGATACCAGATCCCTTCCCAACCCCTTTGCACCGGTCCCACTAAGG
GGCAGGGTCGAGAGAGGAGGGGGGATAGGGGGAGCAGACCCCTGAGATCTGGGCATAGGC
ACCGCATTCTGATCTGGACAAAGTCGGGACAGCACCATCCCAGCCCCGAAGCCAGGGCCA
TGCCAGCAGGCCCCACCATGGAAATCAAAACACCGCACCAGCCAGCAGAATGGACATTCT
GACATCGCCAGCCGACGCCCTGAATCTTGGTGCAGCACCAACCGCGTGCCTGTGTGGCGG
GACTGGAGGGCACAGTTGAGGAAGGAGGGTGGTTAAGAAATACAGTGGGGCCCTCTCGCT
GTCCCTTGCCCAGGGCACTTGCATTCCAGCCTCGCTGCATTTGCTCTCTCGATTCCCCTT
TCCTCCTCACTGCCTCCCAAGCCCACCCTACTCCAAAATAATGTGTCACTTGATTTGGAA
CTATTCAAGCAGNTAAAGTAAATGAAATCCACCTTTACTAAAACACTTTCTCTGAAACCC
CCCTTGCCCCTCACTGATCTTGCTTTTCCCTGGTCTCATGCAGNTGTGGTCAATATTGTG
GGTATCGCTTATTGTACTGATTGNTTAAGTGTGCATTAGNTGTGTCTCCCCAGCTAGATT
GTAAGCTCCTGGAGGACAGGACCCACCTCTACAAAAAAAAAAAAAAACTCGCTCT
Restriction Sites NotI-NotI     
ACCN NM_181689
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_181689.1, NP_859017.1
RefSeq Size 1257 bp
RefSeq ORF 165 bp
Locus ID 4826
UniProt ID Q16517
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a proteolipid that may be involved in the regulation of ion channels during brain development. The encoded protein may also play a role in forming and maintaining the structure of the nervous system. This gene is found within an intron of another gene, bladder cancer associated protein, but on the opposite strand. This gene is imprinted and is expressed only from the paternal allele. [provided by RefSeq, Apr 2016]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1, resulting in an isoform (beta) that is shorter compared to isoform alpha.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...