United States
Germany
Japan
United Kingdom
China
ENSA (NM_004436) Human Untagged Clone
CAT＃: SC127196
ENSA (untagged)-Human endosulfine alpha (ENSA), transcript variant 3
CNY 1,800.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ARPP-19e |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_004436, the custom clone sequence may differ by one or more nucleotides
ATGTCCCAGAAACAAGAAGAAGAGAACCCTGCGGAGGAGACCGGCGAGGAGAAGCAGGACACGCAGGAGA AAGAAGGTATTCTGCCTGAGAGAGCTGAAGAGGCAAAGCTAAAGGCCAAATACCCAAGCCTAGGACAAAA GCCTGGAGGCTCCGACTTCCTCATGAAGAGACTCCAGAAAGGGCAAAAGTACTTTGACTCAGGAGACTAC AACATGGCCAAAGCCAAGATGAAGAATAAGCAGCTGCCAAGTGCAGGACCAGACAAGAACCTGGTGACTG GTGATCACATCCCCACCCCACAGGATCTGCCCCAGAGAAAGTCCTCGCTCGTCACCAGCAAGCTTGCGGG TGGCCAAGTTGAATGA >OriGene 5' read for NM_004436 unedited
GCACGAGGATTTTGACTGAGCAACCCTAGTGACAGGAGCCGAAGCAGCAGCGCAGGTTGT CCCCGTTTCCCCTCCCCCTTCCCTTCTCCGGTTGCCTTCCCGGGCCCCTTACACTCCACA GTCCCGGTCCCGCCATGTCCCAGAAACAAGAAGAAGAGAACCCTGCGGAGGAGACCGGCG AGGAGAAGCAGGACACGCAGGAGAAAGAAGGTATTCTGCCTGAGAGAGCTGAAGAGGCAA AGCTAAAGGCCAAATACCCAAGCCTAGGACAAAAGCCTGGAGGCTCCGACTTCCTCATGA AGAGACTCCAGAAAGGGCAAAAGTACTTTGACTCAGGAGACTACAACATGGCCAAAGCCA AGATGAAGAATAAGCAGCTGCCAAGTGCAGGACCAGACAAGAACCTGGTGACTGGTGATC ACATCCCCACCCCACAGGATCTGCCCCAGAGAAAGTCCTCGCTCGTCACCAGCAAGCTTG CGGGTGGCCAAGTTGAATGATGCTGCCCGGGGCTCTGCCAGATCCTGAGACGCTTCCCCT CCCTGCCCCACCCGGGTCCTGTGCTGGCTCCTGCCCCTTCCTGCTTTTGCAGCCAGGGGT CAGGAGGTGGCTCGGGTGTGGGCTGGAGAGGCAGAAGCCCTTTCCTGTTGGTGTCCCAGC ACATGGAGCCCCTTGGGCTGAGCAC |
| Restriction Sites | NotI-NotI |
| ACCN | NM_004436 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004436.2, NP_004427.1 |
| RefSeq Size | 1252 bp |
| RefSeq ORF | 366 bp |
| Locus ID | 2029 |
| UniProt ID | O43768 |
| Domains | endosulfine |
| Protein Families | Druggable Genome |
| Gene Summary | The protein encoded by this gene belongs to a highly conserved cAMP-regulated phosphoprotein (ARPP) family. This protein was identified as an endogenous ligand for the sulfonylurea receptor, ABCC8/SUR1. ABCC8 is the regulatory subunit of the ATP-sensitive potassium (KATP) channel, which is located on the plasma membrane of pancreatic beta cells and plays a key role in the control of insulin release from pancreatic beta cells. This protein is thought to be an endogenous regulator of KATP channels. In vitro studies have demonstrated that this protein modulates insulin secretion through the interaction with KATP channel, and this gene has been proposed as a candidate gene for type 2 diabetes. At least eight alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3), also known as alpha endosulfine, lacks an in-frame coding segment compared to variant 1. The resulting isoform (3) lacks an internal region, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201350 | ENSA (Myc-DDK-tagged)-Human endosulfine alpha (ENSA), transcript variant 3 |
CNY 1,800.00 |
|
| RC201350L1 | Lenti-ORF clone of ENSA (Myc-DDK-tagged)-Human endosulfine alpha (ENSA), transcript variant 3 |
CNY 4,200.00 |
|
| RC201350L2 | Lenti-ORF clone of ENSA (mGFP-tagged)-Human endosulfine alpha (ENSA), transcript variant 3 |
CNY 6,840.00 |
|
| RC201350L3 | Lenti-ORF clone of ENSA (Myc-DDK-tagged)-Human endosulfine alpha (ENSA), transcript variant 3 |
CNY 6,840.00 |
|
| RC201350L4 | Lenti-ORF clone of ENSA (mGFP-tagged)-Human endosulfine alpha (ENSA), transcript variant 3 |
CNY 6,840.00 |
|
| RG201350 | ENSA (tGFP-tagged) - Human endosulfine alpha (ENSA), transcript variant 3 |
CNY 5,420.00 |
