STARD5 (NM_030574) Human Untagged Clone

CAT#: SC126625

STARD5 (untagged)-Human START domain containing 5 (STARD5), transcript variant 2



CNY 1,200.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-STARD5 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MGC10327; StAR-related lipid transfer (START) domain containing 5; StAR-related lipid transfer protein 5; START domain containing 5
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_030574, the custom clone sequence may differ by one or more nucleotides


ATGGACCCGGCGCTGGCAGCCCAGATGAGCGAGGCTGTGGCCGAGAAGATGCTCCAGTACCGGCGGGACA
CAGCAGGCTGGAAGATTTGCCGGGAAGGCGTACCGAGGAGAAGGCATTGTATATGGGACACTAGAGGAGG
TGTGGGACTGTGTGAAGCCAGCTGTTGGAGGCCTACGAGTGAAGTGGGATGA


>OriGene 5' read for NM_030574 unedited
NAAGCGGTCAAATATTGTATACGACTCACTATAGGCGGCCGCGACATTCGCACGAGGNAG
AACCTCCACTCCCTCCGCTGCCATGAAGCTCAGTTCTCCCAGAGATTTTGTGGACTTGGT
GCTAGTCAAGAGATATGAGGATGGGACCATCAGTTCCAACGCCACCCATGTGGAGCATCC
GTTATGTCCCCCGAAGCCAGGTTTTGTGAGAGGATTTAACCATCCTTGTGGTTGCTTCTG
TGAACCTCTTCCAGGGGAACCCACCAAGACCAACCTGGTCACATTCTTCCATACCGACCT
CAGCGGTTACCTCCCACAGAACGTGGTGGACTCCTTCTTCCCCCGCAGCATGACCCGGTT
TTATGCCAACCTTCAGAAAGCAGTGAAGCAATTCCATGAGTAATGCTATCGTTACTTCTT
GGCAAAGAACTCCCGTGACTCATCGAGGAGCTCCAGCTGTTGGGACACCAAGGAGCCTGG
GAGCACGCAGAGGCCTGTGTTCACTCTTTGGAACAAGCTGATGGACTGCGCATCTCTGAG
AATGCCAACCAGAGGCGGCAGCCCACCCTTCCTGCCTCCTGCCCCACTCAGGGTTGGCGT
GTGATGAGCCATTCATGTGTTCCAAACTCCATCTGCCTGTTACCCAAACACGCCTCTCCT
GGCAGGGTAGACCCAGGCCTCTAACCATCTGACAGAGACTCGGCCTGGACACCATGCGAT
GCACTCTGGCACCAAGGCTTTATGTGCCCATCACTCTCAGAGACCACGTTTCCCTGACTG
TCATAGAGAATCATCATCGCCACTGAAAACCAGGCCCTGTTGCCTTTTAAGCATGTACCG
CTCCCTCAGTCCTGTGCTGCAGCCCCCCAATATATTTTTCTGATATAGACCTTGTATC
Restriction Sites NotI-NotI     
ACCN NM_030574
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_030574.1, NP_085051.1
RefSeq Size 1294 bp
RefSeq ORF 321 bp
Locus ID 80765
Gene Summary Proteins containing a steroidogenic acute regulatory-related lipid transfer (START) domain are often involved in the trafficking of lipids and cholesterol between diverse intracellular membranes. This gene is a member of the StarD subfamily that encodes START-related lipid transfer proteins. The protein encoded by this gene is a cholesterol transporter and is also able to bind and transport other sterol-derived molecules related to the cholesterol/bile acid biosynthetic pathways such as 25-hydroxycholesterol. Its expression is upregulated during endoplasmic reticulum (ER) stress. The protein is thought to act as a cytosolic sterol transporter that moves cholesterol between intracellular membranes such as from the cytoplasm to the ER and from the ER to the Golgi apparatus. Alternative splicing of this gene produces multiple transcript variants. [provided by RefSeq, Jan 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...