P2X2 (P2RX2) (NM_174873) Human Untagged Clone
CAT#: SC125602
P2RX2 (untagged)-Human purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2), transcript variant 2
CNY 6,560.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DFNA41; P2X2 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_174873, the custom clone sequence may differ by one or more nucleotides
ATGGCCGCCGCCCAGCCCAAGTACCCCGCCGGGGCGACCGCCCGGCGCCTGGCCCGGGGCTGCTGGTCCG CCCTCTGGGACTACGAGACGCCCAAGGTGATCGTGGTGAGGAACCGGCGCCTGGGGGTCCTGTACCGCGC CGTGCAGCTGCTCATCCTGCTCTACTTCGTGTGGTACGTATTCATCGTGCAGAAAAGCTACCAGGAGAGC GAGACGGGCCCCGAGAGCTCCATCATCACCAAGGTCAAGGGGATCACCACGTCCGAGCACAAAGTGTGGG ACGTGGAGGAGTACGTGAAGCCCCCCGAGGGGGGCAGCGTGTTCAGCATCATCACCAGGGTCGAGGCCAC CCACTCCCAGACCCAGGGAACCTGCCCCGAGAGCATAAGGGTCCACAACGCCACCTGCCTCTCCGACGCC GACTGCGTGGCTGGGGAGCTGGACATGCTGGGAAACGGCCTGAGGACTGGGCGCTGTGTGCCCTATTACC AGGGGCCCTCCAAGACCTGCGAGGTGTTCGGCTGGTGCCCGGTGGAAGATGGGGCCTCTGTCAGCCAATT TCTGGGTACGATGGCCCCAAATTTCACCATCCTCATCAAGAACAGCATCCACTACCCCAAATTCCACTTC TCCAAGGGCAACATCGCCGACCGCACAGACGGGTACCTGAAGCGCTGCACGTTCCACGAGGCCTCCGACC TCTACTGCCCCATCTTCAAGCTGGGCTTTATCGTGGAGAAGGCTGGGGAGAGCTTCACAGAGCTCGCACA CAAGGGTGGTGTCATCGGGGTCATTATCAACTGGGACTGTGACCTGGACCTGCCTGCATCGGAGTGCAAC CCCAAGTACTCCTTCCGGAGGCTTGACCCCAAGCACGTGCCTGCCTCGTCAGGCTACAACTTCAGGTTTG CCAAATACTACAAGATCAATGGCACCACCACCCGCACGCTCATCAAGGCCTACGGGATCCGCATTGACGT CATTGTGCATGGACAGGCCGGGAAGTTCAGCCTGATTCCCACCATTATTAATCTGGCCACAGCTCTGACT TCCGTCGGGGTGGGCTCCTTCCTGTGCGACTGGATCTTGCTAACATTCATGAACAAAAACAAGGTCTACA GCCATAAGAAATTTGACAAGATGGTGGACACTCCTGCCTCCGAGCCTGCCCAAGCCTCCACACCCACAGA CCCCAAAGGTTTGGCTCAACTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_174873 |
Insert Size | 1550 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_174873.1, NP_777362.1 |
RefSeq Size | 1629 bp |
RefSeq ORF | 1215 bp |
Locus ID | 22953 |
UniProt ID | Q9UBL9 |
Protein Families | Druggable Genome, Ion Channels: ATP Receptors, Transmembrane |
Protein Pathways | Calcium signaling pathway, Neuroactive ligand-receptor interaction |
Gene Summary | The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (2) lacks two alternate in-frame segments in the 3' end compared to variant 4. The resulting isoform (B) has the same N- and C-termini but is shorter compared to isoform D. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223279 | P2RX2 (Myc-DDK-tagged)-Human purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2), transcript variant 2 |
CNY 3,990.00 |
|
RC223279L3 | Lenti-ORF clone of P2RX2 (Myc-DDK-tagged)-Human purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2), transcript variant 2 |
CNY 5,890.00 |
|
RC223279L4 | Lenti-ORF clone of P2RX2 (mGFP-tagged)-Human purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2), transcript variant 2 |
CNY 5,890.00 |
|
RG223279 | P2RX2 (tGFP-tagged) - Human purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2), transcript variant 2 |
CNY 4,370.00 |