United States
Germany
Japan
United Kingdom
China
TPSD1 (NM_012217) Human Untagged Clone
CAT＃: SC125593
TPSD1 (untagged)-Human tryptase delta 1 (TPSD1)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MCP7-LIKE; MCP7L1; MMCP-7L |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_012217, the custom clone sequence may differ by one or more nucleotides
ATGCTCCTCCTTGCTCCCCAGATGCTGAGCCTGCTGCTGCTGGCGCTGCCCGTCCTGGCGAGCCCGGCCT ACGTGGCCCCTGCCCCAGGCCAGGCCCTGCAGCAAACGGGCATTGTTGGGGGGCAGGAGGCCCCCAGGAG CAAGTGGCCCTGGCAGGTGAGCCTGAGAGTCCGCGGCCCATACTGGATGCACTTCTGCGGGGGCTCCCTC ATCCACCCCCAGTGGGTGCTAACCGCGGCGCACTGCGTGGAACCGGACATCAAGGATCTGGCCGCCCTCA GGGTGCAACTGCGGGAGCAGCACCTCTACTACCAGGACCAGCTGCTGCCGGTCAGCAGGATCATCGTGCA CCCACAGTTCTACATCATCCAGACCGGGGCGGACATCGCCCTGCTGGAGCTGGAGGAGCCCGTGAACATC TCCAGCCACATCCACACGGTCACGCTGCCCCCTGCCTCGGAGACCTTCCCCCCGGGGATGCCGTGCTGGG TCACTGGCTGGGGCGACGTGGACAATAATGTGCACCTGCCGCCGCCATACCCGCTGAAGGAGGTGGAAGT CCCCGTAGTGGAAAACCACCTTTGCAACGCGGAATATCACACCGGCCTCCATACGGGCCACAGCTTTCAA ATCGTCCGCGATGACATGCTGTGTGCGGGGAGCGAAAATCACGACTCCTGCCAGGGTGACTCTGGAGGGC CCCTGGTCTGCAAGGTGAATGGCACCTAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_012217 |
| Insert Size | 1500 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_012217.2, NP_036349.1 |
| RefSeq Size | 855 bp |
| RefSeq ORF | 729 bp |
| Locus ID | 23430 |
| UniProt ID | Q9BZJ3 |
| Protein Families | Druggable Genome, Protease, Secreted Protein |
| Gene Summary | Tryptases comprise a family of trypsin-like serine proteases, the peptidase family S1. Tryptases are enzymatically active only as heparin-stabilized tetramers, and they are resistant to all known endogenous proteinase inhibitors. Several tryptase genes are clustered on chromosome 16p13.3. These genes are characterized by several distinct features. They have a highly conserved 3' UTR and contain tandem repeat sequences at the 5' flank and 3' UTR which are thought to play a role in regulation of the mRNA stability. Although this gene may be an exception, most of the tryptase genes have an intron immediately upstream of the initiator Met codon, which separates the site of transcription initiation from protein coding sequence. This feature is characteristic of tryptases but is unusual in other genes. Tryptases have been implicated as mediators in the pathogenesis of asthma and other allergic and inflammatory disorders. This gene was once considered to be a pseudogene, although it is now believed to be a functional gene that encodes a protein. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211637 | TPSD1 (Myc-DDK-tagged)-Human tryptase delta 1 (TPSD1) |
CNY 2,400.00 |
|
| RC211637L3 | Lenti ORF clone of Human tryptase delta 1 (TPSD1), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC211637L4 | Lenti ORF clone of Human tryptase delta 1 (TPSD1), mGFP tagged |
CNY 5,890.00 |
|
| RG211637 | TPSD1 (tGFP-tagged) - Human tryptase delta 1 (TPSD1) |
CNY 4,370.00 |
