RAC1 (NM_006908) Human Untagged Clone

CAT#: SC124449

RAC1 (untagged)-Human ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) (RAC1), transcript variant Rac1



  "NM_006908" in other vectors (6)

CNY 2,400.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Phospho-RAC1-S71 Rabbit Polyclonal Antibody
    • 100 ul

CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MIG5; MRD48; p21-Rac1; Rac-1; TC-25
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_006908, the custom clone sequence may differ by one or more nucleotides


ATGCAGGCCATCAAGTGTGTGGTGGTGGGAGACGGAGCTGTAGGTAAAACTTGCCTACTGATCAGTTACA
CAACCAATGCATTTCCTGGAGAATATATCCCTACTGTCTTTGACAATTATTCTGCCAATGTTATGGTAGA
TGGAAAACCGGTGAATCTGGGCTTATGGGATACAGCTGGACAAGAAGATTATGACAGATTACGCCCCCTA
TCCTATCCGCAAACAGATGTGTTCTTAATTTGCTTTTCCCTTGTGAGTCCTGCATCATTTGAAAATGTCC
GTGCAAAGTGGTATCCTGAGGTGCGGCACCACTGTCCCAACACTCCCATCATCCTAGTGGGAACTAAACT
TGATCTTAGGGATGATAAAGACACGATCGAGAAACTGAAGGAGAAGAAGCTGACTCCCATCACCTATCCG
CAGGGTCTAGCCATGGCTAAGGAGATTGGTGCTGTAAAATACCTGGAGTGCTCGGCGCTCACACAGCGAG
GCCTCAAGACAGTGTTTGACGAAGCGATCCGAGCAGTCCTCTGCCCGCCTCCCGTGAAGAAGAGGAAGAG
AAAATGCCTGCTGTTGTAA


>OriGene 5' read for NM_006908 unedited
CCCCCCCCCCCGGCCNNCCCNNCCTTTCCCCCCCCCCTTTTCANATTTGTATACGACTCC
TATAGGCGGCCGCGNAATTCGCACCAGGTGGCCGCTGCCGGGCATCGGCTTCCAGTCCGC
GGAGGGCGAGGCGGCGTGGACAGCGGCCCCGGCACCCAGCGCCCCGCCGCCCGCAAGCCG
CGCGCCCGTCCGCCGCGCCCCGAGCCCGCCGCTTCCTATCTCAGCGCCCTGCCGCCGCCG
CCGCGGCCCAGCGAGCGGCCCTGATGCAGGCCATCAAGTGTGTGGTGGTGGGAGACGGAG
CTGTAGGTAAAACTTGCCTACTGATCAGTTACACAACCAATGCATTTCCTGGAGAATATA
TCCCTACTGTCTTTGACAATTATTCTGCCAATGTTATGGTAGATGGAAAACCGGTGAATC
TGGGCTTATGGGATACAGCTGGACAAGAAGATTATGACAGATTACGCCCCCTATCCTATC
CGCAAACAGATGTGTTCTTAATTTGCTTTTCCCTTGTGAGTCCTGCATCATTTGAAAATG
TCCGTGCAAAGTGGTATCCTGAGGTGCGGCACCACTGTCCCAACACTCCCATCATCCTAG
TGGGAACTAAACTTGATCTTAGGGATGATAAAGACACGATCGAGAAACTGAAGGAGAAGA
AGCTGACTCCCATCACCTATCCGCAGGGTCTAGCCATGGCTAAGGAGATTGGTGCTGTAA
AATACCTGGAGTGCTCGGCGCTCACACAGCGAGGCCTCAAGACAGTGTTTGACGAAGCGA
TCCGAGCAGTCCTCTGCCCGCCTCCCGTGAAGAAGAGGAAGAGAAATGCCTGNNCTGTGT
AATGTCTCAGCCCTTCGTTCTTTGTNCTGTCCTTTGNNACTTTGTACGCTTTGCTCAAAA
AANAAAAAAT
Restriction Sites NotI-NotI     
ACCN NM_006908
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_006908.3, NP_008839.2
RefSeq Size 2355 bp
RefSeq ORF 579 bp
Locus ID 5879
UniProt ID P63000
Domains ras, RAS, RHO, RAB
Protein Families Druggable Genome
Protein Pathways Adherens junction, Amyotrophic lateral sclerosis (ALS), Axon guidance, B cell receptor signaling pathway, Chemokine signaling pathway, Colorectal cancer, Epithelial cell signaling in Helicobacter pylori infection, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Leukocyte transendothelial migration, MAPK signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Pancreatic cancer, Pathways in cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, Toll-like receptor signaling pathway, VEGF signaling pathway, Viral myocarditis, Wnt signaling pathway
Gene Summary The protein encoded by this gene is a GTPase which belongs to the RAS superfamily of small GTP-binding proteins. Members of this superfamily appear to regulate a diverse array of cellular events, including the control of cell growth, cytoskeletal reorganization, and the activation of protein kinases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Transcript Variant: This variant (Rac1) has a 57 bp in-frame deletion of exon 3b in the coding region, as compared to the variant Rac1b. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...