ALR (GFER) (NM_005262) Human Untagged Clone
CAT#: SC122704
GFER (untagged)-Human growth factor, augmenter of liver regeneration (GFER)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ALR; ERV1; HERV1; HPO; HPO1; HPO2; HSS; MMCHD; MPMCD |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_005262, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCGCCCGGCGAGCGGGGCCGCTTCCACGGCGGGAACCTCTTCTTCCTGCCGGGGGGCGCGCGCT CCGAGATGATGGACGACCTGGCGACCGACGCGCGGGGCCGGGGCGCGGGGCGGAGAGACGCGGCCGCCTC GGCCTCGACGCCAGCCCAGGCGCCGACCTCCGATTCTCCTGTCGCCGAGGACGCCTCCCGGAGGCGGCCG TGCCGGGCCTGCGTCGACTTCAAGACGTGGATGCGGACGCAGCAGAAGCGGGACACCAAGTTTAGGGAGG ACTGCCCGCCGGATCGCGAGGAACTGGGCCGCCACAGCTGGGCTGTCCTCCACACCCTGGCCGCCTACTA CCCCGACCTGCCCACCCCAGAACAGCAGCAAGACATGGCCCAGTTCATACATTTATTTTCTAAGTTTTAC CCCTGTGAGGAGTGTGCTGAAGACCTAAGAAAAAGGCTGTGCAGGAACCACCCAGACACCCGCACCCGGG CATGCTTCACACAGTGGCTGTGCCACCTGCACAATGAAGTGAACCGCAAGCTGGGCAAGCCTGACTTCGA CTGCTCAAAAGTGGATGAGCGCTGGCGCGACGGCTGGAAGGATGGCTCCTGTGACTAG |
Restriction Sites | Please inquire |
ACCN | NM_005262 |
Insert Size | 2400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | A TrueClone. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005262.1, NP_005253.2 |
RefSeq Size | 2447 bp |
RefSeq ORF | 378 bp |
Locus ID | 2671 |
UniProt ID | P55789 |
Gene Summary | The hepatotrophic factor designated augmenter of liver regeneration (ALR) is thought to be one of the factors responsible for the extraordinary regenerative capacity of mammalian liver. It has also been called hepatic regenerative stimulation substance (HSS). The gene resides on chromosome 16 in the interval containing the locus for polycystic kidney disease (PKD1). The putative gene product is 42% similar to the scERV1 protein of yeast. The yeast scERV1 gene had been found to be essential for oxidative phosphorylation, the maintenance of mitochondrial genomes, and the cell division cycle. The human gene is both the structural and functional homolog of the yeast scERV1 gene. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220589 | GFER (Myc-DDK-tagged)-Human growth factor, augmenter of liver regeneration (GFER) |
CNY 3,600.00 |
|
RC220589L1 | Lenti ORF clone of Human growth factor, augmenter of liver regeneration (GFER), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC220589L2 | Lenti ORF clone of Human growth factor, augmenter of liver regeneration (GFER), mGFP tagged |
CNY 6,000.00 |
|
RC220589L3 | Lenti ORF clone of Human growth factor, augmenter of liver regeneration (GFER), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220589L4 | Lenti ORF clone of Human growth factor, augmenter of liver regeneration (GFER), mGFP tagged |
CNY 5,890.00 |
|
RG220589 | GFER (tGFP-tagged) - Human growth factor, augmenter of liver regeneration (GFER) |
CNY 5,200.00 |
|
SC317306 | GFER (untagged)-Human growth factor, augmenter of liver regeneration (GFER) |
CNY 2,640.00 |