MAGEB2 (NM_002364) Human Untagged Clone
CAT#: SC122625
MAGEB2 (untagged)-Human melanoma antigen family B, 2 (MAGEB2)
CNY 3,840.00
Cited in 2 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT3.2; DAM6; MAGE-XP-2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC122625 representing NM_002364.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCTCGTGGTCAGAAGAGTAAGCTCCGTGCCCGTGAGAAACGCCGCAAGGCCCGAGATGAGACCCGG GGTCTCAATGTTCCTCAGGTCACTGAAGCAGAGGAAGAAGAGGCCCCCTGCTGTTCCTCTTCTGTTTCT GGGGGTGCTGCTTCAAGCTCTCCTGCTGCTGGCATTCCCCAGGAGCCTCAGAGAGCCCCAACCACTGCC GCTGCTGCGGCTGCGGGTGTTTCATCCACAAAATCTAAAAAAGGTGCCAAGAGCCACCAAGGTGAGAAA AATGCAAGTTCCTCCCAGGCCTCAACATCCACTAAGAGCCCAAGCGAAGATCCTCTAACCAGGAAGTCA GGGTCGTTGGTGCAGTTCCTGTTGTACAAGTATAAAATAAAAAAGTCCGTTACAAAGGGAGAAATGCTG AAAATTGTTGGCAAAAGGTTCAGGGAGCACTTCCCTGAGATCCTCAAGAAAGCCTCTGAGGGCCTCAGT GTTGTCTTTGGCCTTGAGCTGAATAAAGTCAACCCCAACGGCCACACTTACACCTTCATCGACAAGGTA GACCTCACTGATGAGGAATCCCTGCTCAGTTCCTGGGACTTTCCCAGGAGAAAGCTTCTGATGCCTCTC CTGGGTGTGATCTTCTTAAATGGCAACTCAGCTACTGAGGAAGAGATCTGGGAATTCCTGAATATGTTG GGAGTCTATGATGGAGAGGAGCACTCAGTCTTTGGGGAACCCTGGAAGCTCATCACCAAAGATCTGGTG CAGGAAAAATATCTGGAGTACAAGCAGGTGCCCAGCAGTGATCCCCCACGCTTTCAATTCCTGTGGGGT CCGAGAGCCTATGCTGAAACCAGCAAGATGAAAGTCCTGGAGTTTTTGGCCAAGGTAAATGGTACCACC CCCTGTGCCTTCCCAACCCATTACGAAGAAGCTTTGAAAGATGAAGAGAAAGCCGGAGTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_002364 |
Insert Size | 960 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002364.4 |
RefSeq Size | 1628 bp |
RefSeq ORF | 960 bp |
Locus ID | 4113 |
UniProt ID | O15479 |
MW | 35.3 kDa |
Gene Summary | This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. This gene is localized in the DSS (dosage-sensitive sex reversal) critical region. It is expressed in testis and placenta, and in a significant fraction of tumors of various histological types. The MAGEB genes are clustered on chromosome Xp22-p21. [provided by RefSeq, Jul 2008] |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Proteome-wide survey of the autoimmune target repertoire in autoimmune polyendocrine syndrome type 1
,null,
Scientific Reports
,PubMed ID 26830021
[MAGEB2]
|
MAGEB2 is Activated by Promoter Demethylation in Head and Neck Squamous Cell Carcinoma
,null,
PLoS ONE
,PubMed ID 23029077
[MAGEB2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205338 | MAGEB2 (Myc-DDK-tagged)-Human melanoma antigen family B, 2 (MAGEB2) |
CNY 3,600.00 |
|
RC205338L1 | Lenti ORF clone of Human melanoma antigen family B, 2 (MAGEB2), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC205338L2 | Lenti ORF clone of Human melanoma antigen family B, 2 (MAGEB2), mGFP tagged |
CNY 6,000.00 |
|
RC205338L3 | Lenti ORF clone of Human melanoma antigen family B, 2 (MAGEB2), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC205338L4 | Lenti ORF clone of Human melanoma antigen family B, 2 (MAGEB2), mGFP tagged |
CNY 6,000.00 |
|
RG205338 | MAGEB2 (tGFP-tagged) - Human melanoma antigen family B, 2 (MAGEB2) |
CNY 5,200.00 |