S100 alpha 2 (S100A2) (NM_005978) Human Untagged Clone

CAT#: SC121135

S100A2 (untagged)-Human S100 calcium binding protein A2 (S100A2)



  "NM_005978" in other vectors (6)

CNY 1,200.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit monoclonal anti-S10A2 antibody for SISCAPA, clone OTIR4F6
    • 100 ul

CNY 4,390.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAN19; S100L
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC121135 sequence for NM_005978 edited (data generated by NextGen Sequencing)
ATGTGCAGTTCTCTGGAGCAGGCGCTGGCTGTGCTGGTCACTACCTTCCACAAGTACTCC
TGCCAAGAGGGCGACAAGTTCAAGCTGAGTAAGGGGGAAATGAAGGAACTTCTGCACAAG
GAGCTGCCCAGCTTTGTGGGGGAGAAAGTGGATGAGGAGGGGCTGAAGAAGCTGATGGGC
AGCCTGGATGAGAACAGTGACCAGCAGGTGGACTTCCAGGAGTATGCTGTTTTCCTGGCA
CTCATCACTGTCATGTGCAATGACTTCTTCCAGGGCTGCCCAGACCGACCCTGA

Clone variation with respect to NM_005978.3
>OriGene 5' read for NM_005978 unedited
AAGACGTCAGGATTTGTATACGACTTACTATAGGCGGCCGCGCAATTCGCACGAGGCTCC
CCTCACCCCGGTCCAGGATGCCCAGTCCCCACGACACCTCCCACTTCCCACTGTGGCCTG
GGTGGGCTCAGGGGCTGCCCTTGACCTGGCCTAGAGCCCTCCCCCAGCTGGTGGTGGAGC
TGGCACTCTCTGGGAGGGAGGGGGCTGGGAGGGAATGAGTGGGAATGGCAAGAGGCCAGG
GTTTGGTGGGATCAGGTTGAGGCAGGTTTGGTTTCCTTAAAATGCCAAGTTGGGGGCCAG
TGGGGCCCACATATAAATCCTCACCCTGGGAGCCTGGCTGCCTTGCTCTCCTTCCTGGGT
CTGTCTCTGCCACCTGGTCTGCCACAGATCCATGATGTGCAGTTCTCTGGAGCAAGCGCT
GGCTGTGCTGGTCACTACCTTCCACAAGTACTCCTGCCAAGAGGGCGACAAGTTCAAGCT
GAGTAAGGGGGAAATGAAGGAACTTCTGCACAAGGAGCTGCCCAGCTTTGTGGGGGAGAA
AGTGGATGAGGAGGGGCTGAAGAAGCTGATGGGCAGCCTGGATGAGAACAGTGACCAGCA
GGTGGACTTCCAGGAGTATGCTGTTTTCCTGGCACTCATCACTGTCATGTGCAATGACTT
CTTCCAGGGCTGCCCAGACCGACCCTGAAGCAGAACTCTTGACTTCCTGCCATGGATCTT
TTGGGCCCAAGACTGTTGATGCCTTTGAGTTTTGGATTCAATAAACTTTTTTTGTCTGTT
GAANAAAAAAAATNAGAAAAAATTCCTCGACTCTAGATTTGCGCCGCGGTCATAGCTGTT
TCCCTGACAGATTCAG
Restriction Sites Please inquire     
ACCN NM_005978
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005978.3, NP_005969.1
RefSeq Size 970 bp
RefSeq ORF 294 bp
Locus ID 6273
UniProt ID P29034
Gene Summary The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may have a tumor suppressor function. Chromosomal rearrangements and altered expression of this gene have been implicated in breast cancer. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. CCDS Note: The coding region has been updated to extend the N-terminus to one that is more supported by available proteomics data.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...