METTL11A (NTMT1) (NM_014064) Human Untagged Clone
CAT#: SC120836
NTMT1 (untagged)-Human methyltransferase like 11A (METTL11A)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AD-003; C9orf32; HOMT1A; METTL11A; NRMT; NRMT1; NTM1A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_014064, the custom clone sequence may differ by one or more nucleotides
ATGACGAGCGAGGTGATAGAAGACGAGAAGCAATTCTATTCCAAGGCCAAGACCTACTGGAAACAAATCC CACCCACGGTGGACGGCATGCTTGGGGGGTATGGCCACATCTCCAGCATCGACATCAACAGCTCCCGGAA GTTTCTGCAGAGGTTTTTGAGGGAAGGCCCGAACAAGACAGGAACGTCCTGTGCCCTGGACTGTGGAGCT GGCATTGGGAGGATCACCAAGCGGCTGCTCCTGCCGCTGTTCAGAGAGGTGGATATGGTCGACATAACGG AGGACTTCCTGGTTCAAGCCAAGACCTACCTGGGGGAGGAGGGCAAGAGGGTGAGGAACTACTTCTGTTG TGGGCTCCAGGACTTCACCCCGGAGCCGGACTCTTACGACGTGATCTGGATCCAGTGGGTGATAGGCCAC CTCACCGATCAGCACCTGGCCGAGTTCCTGCGGCGCTGCAAGGGCAGCCTCCGCCCCAACGGCATCATCG TCATCAAAGACAACATGGCCCAGGAGGGCGTGATTCTGGACGACGTGGACAGCAGCGTGTGCCGGGACCT TGACGTGGTCCGCAGGATCATCTGCAGTGCAGGCCTCAGCCTCCTGGCCGAGGAGAGGCAGGAGAACCTC CCCGATGAGATCTACCATGTCTATAGCTTTGCCCTGAGATGA |
Restriction Sites | Please inquire |
ACCN | NM_014064 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014064.2, NP_054783.2 |
RefSeq Size | 1007 bp |
RefSeq ORF | 672 bp |
Locus ID | 28989 |
UniProt ID | Q9BV86 |
Protein Families | Druggable Genome |
Gene Summary | The METTL11A gene encodes an N-terminal methyltransferase for the RAN (MIM 601179) guanine nucleotide exchange factor regulator of chromosome condensation 1 (RCC1; MIM 179710). METTL11A enzyme alpha-N-methylates other protein targets such as SET (MIM 600960) and RB (MIM 180200).[supplied by OMIM, Nov 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 through 5 all encode isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200055 | NTMT1 (Myc-DDK-tagged)-Human methyltransferase like 11A (METTL11A) |
CNY 2,400.00 |
|
RC200055L3 | Lenti ORF clone of Human methyltransferase like 11A (METTL11A), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200055L4 | Lenti ORF clone of Human methyltransferase like 11A (METTL11A), mGFP tagged |
CNY 5,890.00 |
|
RG200055 | NTMT1 (tGFP-tagged) - Human methyltransferase like 11A (METTL11A) |
CNY 4,000.00 |