Angiotensin II Type 2 Receptor (AGTR2) (NM_000686) Human Untagged Clone
CAT#: SC119766
AGTR2 (untagged)-Human angiotensin II receptor, type 2 (AGTR2)
CNY 3,656.00
CNY 7,220.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AT2; ATGR2; MRX88 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_000686, RT-PCR generated
ATGAAGGGCAACTCCACCCTTGCCACTACTAGCAAAAACATTACCAGCGGTCTTCACTTC GGGCTTGTGAACATCTCTGGCAACAATGAGTCTACCTTGAACTGTTCACAGAAACCATCA GATAAGCATTTAGATGCAATTCCTATTCTTTACTACATTATATTTGTAATTGGATTTCTG GTCAATATTGTCGTGGTTACACTGTTTTGTTGTCAAAAGGGTCCTAAAAAGGTTTCTAGC ATATACATCTTCAACCTCGCTGTGGCTGATTTACTCCTTTTGGCTACTCTTCCTCTATGG GCAACCTATTATTCTTATAGATATGACTGGCTCTTTGGACCTGTGATGTGCAAAGTTTTT GGTTCTTTTCTTACCCTGAACATGTTTGCAAGCATTTTTTTTATCACCTGCATGAGTGTT GATAGGTACCAATCTGTCATCTACCCCTTTCTGTCTCAAAGAAGAAATCCCTGGCAAGCA TCTTATATAGTTCCCCTTGTTTGGTGTATGGCCTGTTTGTCCTCATTGCCAACATTTTAT TTTCGAGACGTCAGAACCATTGAATACTTAGGAGTGAATGCTTGCATTATGGCTTTCCCA CCTGAGAAATATGCCCAATGGTCAGCTGGGATTGCCTTAATGAAAAATATCCTTGGTTTT ATTATCCCTTTAATATTCATAGCAACATGCTATTTTGGAATTAGAAAACACTTACTGAAG ACGAATAGCTATGGGAAGAACAGGATAACCCGTGACCAAGTCCTGAAGATGGCAGCTGCT GTTGTTCTGGCCTTCATCATTTGCTGGCTTCCCTTCCATGTTCTGACCTTCCTGGATGCT CTGGCCTGGATGGGTGTCATTAATAGCTGCGAAGTTATAGCAGTCATTGACCTGGCACTT CCTTTTGCCATCCTCTTGGGATTCACCAACAGCTGCGTTAATCCGTTTCTGTATTGTTTT GTTGGAAACCGGTTCCAACAGAAGCTCCGCAGTGTGTTTAGGGTTCCAATTACTTGGCTC CAAGGGAAAAGAGAGAGTATGTCTTGCCGGAAAAGCAGTTCTCTTAGAGAAATGGAGACC TTTGTGTCTTAA |
Chromatograms |
CHROMATOGRAMS
![]() Sequencher program is needed, download here. |
Restriction Sites | Please inquire |
ACCN | NM_000686 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000686.3, NP_000677.2 |
RefSeq Size | 2448 bp |
RefSeq ORF | 1092 bp |
Locus ID | 186 |
UniProt ID | P50052 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction, Renin-angiotensin system |
Gene Summary | The protein encoded by this gene belongs to the G-protein coupled receptor 1 family, and functions as a receptor for angiotensin II. It is an intergral membrane protein that is highly expressed in fetus and in neonates, but scantily in adult tissues, except brain, adrenal medulla, and atretic ovary. This receptor has been shown to mediate programmed cell death and this apoptotic function may play an important role in developmental biology and pathophysiology. Mutations in this gene are been associated with X-linked cognitive disability. Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV) and SARS-CoV-2 infection results in down-regulation of angiotensin converting enzyme-2 (ACE2) receptors, the effects of which, triggers serious inflammatory lesions in the tissues involved, primarily in the lungs. The inflammatory reaction appears to be mediated by angiotensin II derivatives, including the angiotensin AT2 receptor which has been found to be upregulated in bronchoalveolar lavage samples from Coronavirus disease 2019 (COVID19) patients. [provided by RefSeq, Jul 2020] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223317 | AGTR2 (Myc-DDK-tagged)-Human angiotensin II receptor, type 2 (AGTR2) |
CNY 3,656.00 |
|
RC223317L1 | Lenti ORF clone of Human angiotensin II receptor, type 2 (AGTR2), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC223317L2 | Lenti ORF clone of Human angiotensin II receptor, type 2 (AGTR2), mGFP tagged |
CNY 5,890.00 |
|
RC223317L3 | Lenti ORF clone of Human angiotensin II receptor, type 2 (AGTR2), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC223317L4 | Lenti ORF clone of Human angiotensin II receptor, type 2 (AGTR2), mGFP tagged |
CNY 6,056.00 |
|
RG223317 | AGTR2 (tGFP-tagged) - Human angiotensin II receptor, type 2 (AGTR2) |
CNY 5,256.00 |
其它Angiotensin II Type 2 Receptor产品