United States
Germany
Japan
United Kingdom
China
DUT (NM_001948) Human Untagged Clone
CAT＃: SC118933
DUT (untagged)-Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | dUTPase |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001948, the custom clone sequence may differ by one or more nucleotides
ATGCCCTGCTCTGAAGAGACACCCGCCATTTCACCCAGTAAGCGGGCCCGGCCTGCGGAGGTGGGCGGCA TGCAGCTCCGCTTTGCCCGGCTCTCCGAGCACGCCACGGCCCCCACCCGGGGCTCCGCGCGCGCCGCGGG CTACGACCTGTACAGTGCCTATGATTACACAATACCACCTATGGAGAAAGCTGTTGTGAAAACGGACATT CAGATAGCGCTCCCTTCTGGGTGTTATGGAAGAGTGGCTCCACGGTCAGGCTTGGCTGCAAAACACTTTA TTGATGTAGGAGCTGGTGTCATAGATGAAGATTATAGAGGAAATGTTGGTGTTGTACTGTTTAATTTTGG CAAAGAAAAGTTTGAAGTCAAAAAAGGTGATCGAATTGCACAGCTCATTTGCGAACGGATTTTTTATCCA GAAATAGAAGAAGTTCAAGCCTTGGATGACACCGAAAGGGGTTCAGGAGGTTTTGGTTCCACTGGAAAGA ATTAA >OriGene 5' read for NM_001948 unedited
CACGAGGCGACGCTCATCGTGCGCTCTCCTCTTCCCCCGGTGGTCTCCTCGCTCGCCTTC TGGCTCTGCCATGCCCTGCTCTGAAGAGACACCCGCCATTTCACCCAGTAAGCGGGCCCG GCCTGCGGAGGTGGGCGGCATGCAGCTCCGCTTTGCCCGGCTCTCCGAGCACGCCACGGC CCCCACCCGGGGCTCCGCGCGCGCCGCGGGCTACGACCTGTACAGTGCCTATGATTACAC AATACCACCTATGGAGAAAGCTGTTGTGAAAACGGACATTCAGATAGCGCTCCCTTCTGG GTGTTATGGAAGAGTGGCTCCACGGTCAGGCTTGGCTGCAAAACACTTTATTGATGTAGG AGCTGGTGTCATAGATGAAGATTATAGAGGAAATGTTGGTGTTGTACTGTTTAATTTTGG CAAAGAAAAGTTTGAAGTCAAAAAAGGTGATCGAATTGCACAGCTCATTTGCGAACGGAT TTTTTATCCAGAAATAGAAGAAGTTCAAGCCTTGGATGACACCGAAA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001948 |
| Insert Size | 1600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001948.3, NP_001939.1 |
| RefSeq Size | 1874 bp |
| RefSeq ORF | 495 bp |
| Locus ID | 1854 |
| UniProt ID | P33316 |
| Domains | dUTPase |
| Protein Families | Druggable Genome |
| Protein Pathways | Metabolic pathways, Pyrimidine metabolism |
| Gene Summary | This gene encodes an essential enzyme of nucleotide metabolism. The encoded protein forms a ubiquitous, homotetrameric enzyme that hydrolyzes dUTP to dUMP and pyrophosphate. This reaction serves two cellular purposes: providing a precursor (dUMP) for the synthesis of thymine nucleotides needed for DNA replication, and limiting intracellular pools of dUTP. Elevated levels of dUTP lead to increased incorporation of uracil into DNA, which induces extensive excision repair mediated by uracil glycosylase. This repair process, resulting in the removal and reincorporation of dUTP, is self-defeating and leads to DNA fragmentation and cell death. Alternative splicing of this gene leads to different isoforms that localize to either the mitochondrion or nucleus. A related pseudogene is located on chromosome 19. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2), also known as DUT-N, uses a different 5' exon, compared to variant 1. It encodes isoform 2, which has a shorter, distinct N-terminus that lacks the mitochondrial targeting sequence, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC221635 | DUT (Myc-DDK-tagged)-Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 1,200.00 |
|
| RC221635L1 | Lenti ORF clone of Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC221635L2 | Lenti ORF clone of Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC221635L3 | Lenti ORF clone of Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC221635L4 | Lenti ORF clone of Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG221635 | DUT (tGFP-tagged) - Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 2,800.00 |
