CEACAM6 (NM_002483) Human Untagged Clone

CAT#: SC118611

CEACAM6 (untagged)-Human carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) (CEACAM6)



  "NM_002483" in other vectors (6)

CNY 3,656.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
CEACAM6 mouse monoclonal antibody,clone OTI5A10
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD66c; CEAL; NCA
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene ORF within SC118611 sequence for NM_002483 edited (data generated by NextGen Sequencing)
ATGGGACCCCCCTCAGCCCCTCCCTGCAGATTGCATGTCCCCTGGAAGGAGGTCCTGCTC
ACAGCCTCACTTCTAACCTTCTGGAACCCACCCACCACTGCCAAGCTCACTATTGAATCC
ACGCCGTTCAATGTCGCAGAGGGGAAGGAGGTTCTTCTACTCGCCCACAACCTGCCCCAG
AATCGTATTGGTTACAGCTGGTACAAAGGCGAAAGAGTGGATGGCAACAGTCTAATTGTA
GGATATGTAATAGGAACTCAACAAGCTACCCCAGGGCCCGCATACAGTGGTCGAGAGACA
ATATACCCCAATGCATCCCTGCTGATCCAGAACGTCACCCAGAATGACACAGGATTCTAT
ACCCTACAAGTCATAAAGTCAGATCTTGTGAATGAAGAAGCAACCGGACAGTTCCATGTA
TACCCGGAGCTGCCCAAGCCCTCCATCTCCAGCAACAACTCCAACCCCGTGGAGGACAAG
GATGCTGTGGCCTTCACCTGTGAACCTGAGGTTCAGAACACAACCTACCTGTGGTGGGTA
AATGGTCAGAGCCTCCCGGTCAGTCCCAGGCTGCAGCTGTCCAATGGCAACATGACCCTC
ACTCTACTCAGCGTCAAAAGGAACGATGCAGGATCCTATGAATGTGAAATACAGAACCCA
GCGAGTGCCAACCGCAGTGACCCAGTCACCCTGAATGTCCTCTATGGCCCAGATGTCCCC
ACCATTTCCCCCTCAAAGGCCAATTACCGTCCAGGGGAAAATCTGAACCTCTCCTGCCAC
GCAGCCTCTAACCCACCTGCACAGTACTCTTGGTTTATCAATGGGACGTTCCAGCAATCC
ACACAAGAGCTCTTTATCCCCAACATCACTGTGAATAATAGCGGATCCTATATGTGCCAA
GCCCATAACTCAGCCACTGGCCTCAATAGGACCACAGTCACGATGATCACAGTCTCTGGA
AGTGCTCCTGTCCTCTCAGCTGTGGCCACCGTCGGCATCACGATTGGAGTGCTGGCCAGG
GTGGCTCTGATATAG

Clone variation with respect to NM_002483.4
716 g=>t
Restriction Sites Please inquire     
ACCN NM_002483
Insert Size 2600 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone in Neo vector.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_002483.3, NP_002474.3
RefSeq Size 2527 bp
RefSeq ORF 1035 bp
Locus ID 4680
UniProt ID P40199
Domains ig
Gene Summary This gene encodes a protein that belongs to the carcinoembryonic antigen (CEA) family whose members are glycosyl phosphatidyl inositol (GPI) anchored cell surface glycoproteins. Members of this family play a role in cell adhesion and are widely used as tumor markers in serum immunoassay determinations of carcinoma. This gene affects the sensitivity of tumor cells to adenovirus infection. The protein encoded by this gene acts as a receptor for adherent-invasive E. coli adhesion to the surface of ileal epithelial cells in patients with Crohn's disease. This gene is clustered with genes and pseudogenes of the cell adhesion molecules subgroup of the CEA family on chromosome 19. [provided by RefSeq, Apr 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...