H4C14 (NM_003548) Human Untagged Clone

CAT#: SC117933

HIST2H4A (untagged)-Human histone cluster 2, H4a (HIST2H4A)



  "NM_003548" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Acetyl-Histone H4-K8 Rabbit polyclonal Antibody
    • 100 ul

CNY 2,900.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FO108; H4; H4-16; H4/n; H4C1; H4C2; H4C3; H4C4; H4C5; H4C6; H4C8; H4C9; H4C11; H4C12; H4C13; H4C15; H4F2; H4FN; HIST2H4; HIST2H4A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_003548 edited
ATGTCCGGCAGAGGAAAGGGCGGAAAAGGCTTAGGCAAAGGGGGCGCTAAGCGCCACCGC
AAGGTCTTGAGAGACAACATTCAGGGCATCACCAAGCCTGCCATTCGGCGTCTAGCTCGG
CGTGGCGGCGTTAAGCGGATCTCTGGCCTCATTTACGAGGAGACCCGCGGTGTGCTGAAG
GTGTTCCTGGAGAATGTGATTCGGGACGCAGTCACCTACACCGAGCACGCCAAGCGCAAG
ACCGTCACAGCCATGGATGTGGTGTACGCGCTCAAGCGCCAGGGGCGCACCCTGTACGGC
TTCGGAGGCTAG
>OriGene 5' read for NM_003548 unedited
CACTATAGGTGCCGGCCGCGTAATTCGGCACGAGGCTCCAGCGGTCATGTCCGGCAGAGG
AAAGGGCGGAAAAGGCTTAGGCAAAGGGGGCGCTAAGCGCCACCGCAAGGTCTTGAGAGA
CAACATTCAGGGCATCACCAAGCCTGCCATTCGGCGTCTAGCTCGGCGTGGCGGCGTTAA
GCGGATCTCTGGCCTCATTTACGAGGAGACCCGCGGTGTGCTGAAGGTGTTCCTGGAGAA
TGTGATTCGGGACGCAGTCACCTACACCGAGCACGCCAAGCGCAAGACCGTCACAGCCAT
GGATGTGGTGTACGCGCTCAAGCGCCAGGGGCGCACCCTGTACGGCTTCGGAGGCTAGGC
CGCCGCTCCAGCTTTGCGCGTTTCGATCCCAAAGGCCCTTTTTAGGGCCGACCACTTGCT
CATCTGAGGAGTTGGACACTTGACTGCGTAAAGTGCAACAGTAACGATGTTGGAAGGTAA
CTTTGGCAGTGGGGCGACAATCGGATCTGAAGTTACGGANAGCTACCGCGGCCCATAGCG
CTCACAGCCGTAAAGACTTAAGTCGTTGACCGAAAGCGGCTTTTTCACTTACCTGGGCTT
TTTTTTTTTTTTTTTTTTTTAAAGCCTTTATCGGTATGAAAGGTTGAATGCTCTANGTTT
CAGCACTGCTTTCTCGGCTTGCTCTTCTGGTGCAGTATAGGCACACCTAGAGGGCCACGT
CAGTCTTTGCGATCACCAAATCTGGTTCTGAGAAATANGCACTGGCAATTTACACATGCC
TTTGCTGTGTAATCTCACTATATTTTGCTCAGGCAAGTGGGGAGAAGCAGCCTTNAGGTT
TTCATTCTAGAGATGCCGGCTTTCCCACCTGATCGGCTTTAGAGTCC
Restriction Sites NotI-NotI     
ACCN NM_003548
Insert Size 2740 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_003548.2, NP_003539.1
RefSeq Size 396 bp
RefSeq ORF 312 bp
Locus ID 8370
UniProt ID P62805
Domains H4, histone
Protein Pathways Systemic lupus erythematosus
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in a histone cluster on chromosome 1. This gene is one of four histone genes in the cluster that are duplicated; this record represents the centromeric copy. [provided by RefSeq, Aug 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...