United States
Germany
Japan
United Kingdom
China
Cystatin F (CST7) (NM_003650) Human Untagged Clone
CAT＃: SC117836
CST7 (untagged)-Human cystatin F (leukocystatin) (CST7)
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CMAP |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_003650, the custom clone sequence may differ by one or more nucleotides
ATGCGAGCGGCTGGAACTCTGCTGGCCTTCTGCTGCCTGGTCTTGAGCACCACTGGGGGCCCTTCCCCAG ATACTTGTTCCCAGGACCTTAACTCACGTGTGAAGCCAGGATTTCCTAAAACAATAAAGACCAATGACCC AGGAGTCCTCCAAGCAGCCAGATACAGTGTTGAAAAGTTCAACAACTGCACGAACGACATGTTCTTGTTC AAGGAGTCCCGCATCACAAGGGCCCTAGTTCAGATAGTGAAAGGCCTGAAATATATGCTGGAGGTGGAAA TTGGCAGAACTACCTGCAAGAAAAACCAGCACCTGCGTCTGGATGACTGTGACTTCCAAACCAACCACAC CTTGAAGCAGACTCTGAGCTGCTACTCTGAAGTCTGGGTCGTGCCCTGGCTCCAGCACTTCGAGGTGCCT GTTCTCCGTTGTCACTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_003650 |
| Insert Size | 1020 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_003650.3, NP_003641.3 |
| RefSeq Size | 940 bp |
| RefSeq ORF | 438 bp |
| Locus ID | 8530 |
| UniProt ID | O76096 |
| Domains | CY |
| Protein Families | Secreted Protein |
| Gene Summary | The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. This gene encodes a glycosylated cysteine protease inhibitor with a putative role in immune regulation through inhibition of a unique target in the hematopoietic system. Expression of the protein has been observed in various human cancer cell lines established from malignant tumors. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202034 | CST7 (Myc-DDK-tagged)-Human cystatin F (leukocystatin) (CST7) |
CNY 2,400.00 |
|
| RC202034L3 | Lenti ORF clone of Human cystatin F (leukocystatin) (CST7), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202034L4 | Lenti ORF clone of Human cystatin F (leukocystatin) (CST7), mGFP tagged |
CNY 5,890.00 |
|
| RG202034 | CST7 (tGFP-tagged) - Human cystatin F (leukocystatin) (CST7) |
CNY 4,000.00 |
其它Cystatin F产品
