Cytochrome C Oxidase subunit VIc (COX6C) (NM_004374) Human Untagged Clone
CAT#: SC117420
COX6C (untagged)-Human cytochrome c oxidase subunit VIc (COX6C), nuclear gene encoding mitochondrial protein
CNY 1,200.00
CNY 2,950.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_004374, the custom clone sequence may differ by one or more nucleotides
ATGGCTCCCGAAGTTTTGCCAAAACCTCGGATGCGTGGCCTTCTGGCCAGGCGTCTGCGAAATCATATGG CTGTAGCATTCGTGCTATCCCTGGGGGTTGCAGCTTTGTATAAGTTTCGTGTGGCTGATCAAAGAAAGAA GGCATACGCAGATTTCTACAGAAACTACGATGTCATGAAAGATTTTGAGGAGATGAGGAAGGCTGGTATC TTTCAGAGTGTAAAGTAA >OriGene 5' read for NM_004374 unedited
GCACGAGGGGACGTTGGTGTTGAGGTTAGCATACGNTATCAGGACAGTAACTACCATGGC TCCCGAAGTTTTGCCAAAACCTCGGATGCGTGGCCTTCTGGCCAGGCGTCTGCGAAATCA TATGGCTGTAGCATTCGTGCTATCCCTGGGGGTTGCAGCTTTGTATAAGTTTCGTGTGGC TGATCAAAGAAAGAAGGCATACGCAGATTTCTACAGAAACTACGATGTCATGAAAGATTT TGAGGAGATGAGGAAGGCTGGTATCTTTCAGAGTGTAAAGTAATCTTGGAATATAAAGAA TTTCTTCAGGTTGAATTACCTAGAAGTTTGTCACTGACTTGTGTTCCTGAACTATGACAC ATGAATATGTGGGCTAAGAAATAGTTCCTCTTGATAAATAAACAATTAACANATANNAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAN |
Restriction Sites | NotI-NotI |
ACCN | NM_004374 |
Insert Size | 4540 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004374.2, NP_004365.1 |
RefSeq Size | 444 bp |
RefSeq ORF | 228 bp |
Locus ID | 1345 |
UniProt ID | P09669 |
Domains | COX6C |
Protein Families | Transmembrane |
Protein Pathways | Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | Cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may be involved in the regulation and assembly of the complex. This nuclear gene encodes subunit VIc, which has 77% amino acid sequence identity with mouse subunit VIc. This gene is up-regulated in prostate cancer cells. A pseudogene has been found on chromosomes 16p12. [provided by RefSeq, Jul 2010] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200374 | COX6C (Myc-DDK-tagged)-Human cytochrome c oxidase subunit VIc (COX6C), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
RC200374L1 | Lenti ORF clone of Human cytochrome c oxidase subunit VIc (COX6C), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC200374L2 | Lenti ORF clone of Human cytochrome c oxidase subunit VIc (COX6C), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RC200374L3 | Lenti ORF clone of Human cytochrome c oxidase subunit VIc (COX6C), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200374L4 | Lenti ORF clone of Human cytochrome c oxidase subunit VIc (COX6C), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG200374 | COX6C (tGFP-tagged) - Human cytochrome c oxidase subunit VIc (COX6C), nuclear gene encoding mitochondrial protein |
CNY 2,800.00 |
其它Cytochrome C Oxidase subunit VIc产品