Stathmin 1 (STMN1) (NM_005563) Human Untagged Clone

CAT#: SC116654

STMN1 (untagged)-Human stathmin 1 (STMN1), transcript variant 3



  "NM_005563" in other vectors (6)

CNY 1,800.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


STMN1 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1orf215; Lag; LAP18; OP18; PP17; PP19; PR22; SMN
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_005563 edited
ATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAGGCTTTT
GAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCCCCTCCA
AAGAAGAAGGATCTTTCCCTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAAGAAAGA
CGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCTGGCTGAGAAACGAGAGCACGAGAAA
GAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAGAAA
CTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAAATGGCTGCCAAACTG
GAACGTTTGCGAGAGAAGGATAAGCACATTGAAGAAGTGCGGAAGAACAAAGAATCCAAA
GACCCTGCTGACGAGACTGAAGCTGACTAA
>OriGene 5' read for NM_005563 unedited
NGGTCGAATTTGTATACGACTCCTATAGGGCGGCCGCGATTCGGCACGAGGCTCGGACTG
AGCAGGACTTTCCTTATCCCAGTTGATTGTGCAGAAACACTGCCTGTCGCTTGTCTTCTA
TTCACCATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAG
GCTTTTGAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCC
CCTCCAAAGAAGAAGGATCTTTCCCTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAA
GAAAGACGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCTGGCTGAGAAACGAGAGCAC
GAGAAAGAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAACTTCAGTAAAATGGCAGAA
GAGAAACTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAAATGGCTGCC
AAACTGGAACGTTTGCGAGAGAAGGATAAGCACATTGAAGAAGTGCGGAAGAACAAAGAA
TCCAAAGACCCTGCTGACGAGACTGAAGCTGACTAATTTGTTCTGAGAACTGACTTTCTC
CCCATCCCCTTCCTAAATATCCAAAGACTGTACTGGCCAGTGTCATTNTATTTTTTCCCT
CCTGNACAATATTTTAGAAGCTAATGTANGACTGTATAGGTAGATCCAGATCCAGACTGG
TAGATGTTGTTTTAGGGGCTAAAGGGGAGAAACTGAAAGTGTTNTACTCTTTTTCTAANA
GTGTGGTCTTTCTAATGTAGCTATTNTTCCTTGGTGCATCTTTTCTACTTCAGTACCTTT
GGTGTACTGGGGTTATGGGCTAGTACTGGNATTGGCTCTGTGAAACATATTTGTGAAAAG
ATATGTAAG
Restriction Sites NotI-NotI     
ACCN NM_005563
Insert Size 1030 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_005563.3, NP_005554.1
RefSeq Size 1542 bp
RefSeq ORF 450 bp
Locus ID 3925
UniProt ID P16949
Domains Stathmin
Protein Pathways MAPK signaling pathway
Gene Summary This gene belongs to the stathmin family of genes. It encodes a ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals of the cellular environment. The encoded protein is involved in the regulation of the microtubule filament system by destabilizing microtubules. It prevents assembly and promotes disassembly of microtubules. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
Transcript Variant: This variant (3) uses an alternate terminal exon, compared to variant 4. The resulting isoform (a) has a shorter and distinct C-terminus, compared to isoform b. Variants 1, 2, and 3 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...