DNAJB2 (NM_001039550) Human Untagged Clone

CAT#: SC115897

DNAJB2 (untagged)-Human DnaJ (Hsp40) homolog, subfamily B, member 2 (DNAJB2), transcript variant 1



  "NM_001039550" in other vectors (4)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
DNAJB2 mouse monoclonal antibody, clone OTI4D12 (formerly 4D12)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMT2T; DSMA5; HSJ-1; HSJ1; HSPF3
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC115897 sequence for NM_001039550 edited (data generated by NextGen Sequencing)
ATGGCATCCTACTACGAGATCCTAGACGTGCCGCGAAGTGCGTCCGCTGATGACATCAAG
AAGGCGTATCGGCGCAAGGCTCTCCAGTGGCACCCAGACAAAAACCCAGATAATAAAGAG
TTTGCTGAGAAGAAATTTAAGGAGGTGGCCGAGGCATATGAAGTGCTGTCTGACAAGCAC
AAGCGGGAGATTTACGACCGCTATGGCCGGGAAGGGCTGACAGGGACAGGAACTGGCCCA
TCTCGGGCAGAAGCTGGCAGTGGTGGGCCTGGCTTCACCTTCACCTTCCGCAGCCCCGAG
GAGGTCTTCCGGGAATTCTTTGGGAGTGGAGACCCTTTTGCAGAGCTCTTTGATGACCTG
GGCCCCTTCTCAGAGCTTCAGAACCGGGGTTCCCGACACTCAGGCCCCTTCTTTACCTTC
TCTTCCTCCTTCCCTGGGCACTCCGATTTCTCCTCCTCATCTTTCTCCTTCAGTCCTGGG
GCTGGTGCTTTTCGCTCTGTTTCTACATCTACCACCTTTGTCCAAGGACGCCGCATCACC
ACACGCAGAATCATGGAGAACGGGCAGGAGCGGGTGGAAGTGGAGGAGGATGGGCAGCTG
AAGTCAGTCACAATCAATGGTGTCCCAGATGACCTGGCACTGGGCTTGGAGCTGAGCCGT
CGCGAGCAGCAGCCGTCAGTCACTTCCAGGTCTGGGGGCACTCAGGTCCAGCAGACCCCT
GCCTCATGCCCCTTGGACAGCGACCTCTCTGAGGATGAGGACCTGCAGCTGGCCATGGCC
TACAGCCTGTCAGAGATGGAGGCAGCTGGGAAGAAACCCGCAGATGTGTTCTGA

Clone variation with respect to NM_001039550.1
Restriction Sites Please inquire     
ACCN NM_001039550
Insert Size 2000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation A TrueClone.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001039550.1, NP_001034639.1
RefSeq Size 1978 bp
RefSeq ORF 834 bp
Locus ID 3300
UniProt ID P25686
Gene Summary This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
Transcript Variant: This variant (1) represents the predominant transcript, and encodes isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...