TPD52L1 (NM_003287) Human Untagged Clone
CAT#: SC112726
TPD52L1 (untagged)-Human tumor protein D52-like 1 (TPD52L1), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | D53; TPD53 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_003287 edited
ATGGAGGCGCAGGCACAAGGTTTGTTGGAGACTGAACCGTTGCAAGGAACAGACGAAGAT GCAGTAGCCAGTGCTGACTTCTCTAGCATGCTCTCTGAGGAGGAAAAGGAAGAGTTAAAA GCAGAGTTAGTTCAGCTAGAAGACGAAATTACAACACTACGACAAGTTTTGTCAGCGAAA GAAAGGCATCTAGTTGAGATAAAACAAAAACTCGGCATGAACCTGATGAATGAATTAAAA CAGAACTTCAGCAAAAGCTGGCATGACATGCAGACTACCACTGCCTACAAGAAAACACAT GAAACCCTGAGTCACGCAGGGCAAAAGGCAACTGCAGCTTTCAGCAACGTTGGAACGGCC ATCAGCAAGAAGTTCGGAGACATGAGTTACTCCATTCGCCATTCCATAAGTATGCCTGCT ATGAGGAATTCTCCTACTTTCAAATCATTTGAGGAGAGGGTTGAGACAACTGTCACAAGC CTCAAGACGAAAGTAGGCGGTACGAACCCTAATGGAGGCAGTTTTGAGGAGGTCCTCAGC TCCACGGCCCATGCCAGTGCCCAGAGCTTGGCAGGAGGCTCCCGGCGGACCAAGGAGGAG GAGCTGCAGTGCTAA |
Restriction Sites | NotI-NotI |
ACCN | NM_003287 |
Insert Size | 4000 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_003287.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_003287.2, NP_003278.1 |
RefSeq Size | 1388 bp |
RefSeq ORF | 615 bp |
Locus ID | 7164 |
UniProt ID | Q16890 |
Domains | TPD52 |
Gene Summary | This gene encodes a member of a family of proteins that contain coiled-coil domains and may form hetero- or homomers. The encoded protein is involved in cell proliferation and calcium signaling. It also interacts with the mitogen-activated protein kinase kinase kinase 5 (MAP3K5/ASK1) and positively regulates MAP3K5-induced apoptosis. Multiple alternatively spliced transcript variants have been observed. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (1) encodes isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218696 | TPD52L1 (Myc-DDK-tagged)-Human tumor protein D52-like 1 (TPD52L1), transcript variant 1 |
CNY 3,990.00 |
|
RC218696L3 | Lenti-ORF clone of TPD52L1 (Myc-DDK-tagged)-Human tumor protein D52-like 1 (TPD52L1), transcript variant 1 |
CNY 5,890.00 |
|
RC218696L4 | Lenti-ORF clone of TPD52L1 (mGFP-tagged)-Human tumor protein D52-like 1 (TPD52L1), transcript variant 1 |
CNY 5,890.00 |
|
RG218696 | TPD52L1 (tGFP-tagged) - Human tumor protein D52-like 1 (TPD52L1), transcript variant 1 |
CNY 4,240.00 |
其它TPD52L1产品