AP3M2 (NM_006803) Human Untagged Clone

CAT#: SC111175

AP3M2 (untagged)-Human adaptor-related protein complex 3, mu 2 subunit (AP3M2), transcript variant 2



  "NM_006803" in other vectors (4)

CNY 2,950.00


货期*
6周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-AP3M2 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AP47B; CLA20; P47B
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_006803, the custom clone sequence may differ by one or more nucleotides


ATGATCCATAGTCTTTTCTTGATCAACTCCTCTGGAGACATTTTCCTGGAGAAACATTGGAAAAGTGTGG
TCAGCCGTTCTGTTTGTGATTACTTTTTTGAGGCGCAAGAGAGAGCTACTGAGGCAGAAAATGTGCCTCC
GGTTATCCCTACCCCTCACCACTATCTCTTAAGTGTTTACCGCCACAAGATCTTTTTTGTGGCCGTGATC
CAGACGGAGGTCCCCCCTCTGTTTGTCATTGAGTTTCTTCACCGAGTGGTGGACACATTTCAGGATTATT
TTGGAGTCTGTTCAGAGCCAGTGATCAAAGACAATGTAGTTGTGGTTTATGAGGTATTGGAAGAGATGCT
TGACAATGGTTTTCCATTGGCTACCGAGTCGAACATTCTTAAAGAACTCATAAAGCCTCCTACCATCCTT
CGAACGGTTGTCAACACCATCACAGGAAGCACGAATGTGGGTGACCAGCTTCCCACTGGGCAGCTGTCAG
TGGTGCCTTGGCGACGGACTGGGGTGAAATATACCAACAATGAGGCCTATTTTGATGTGATTGAAGAGAT
TGATGCAATTATTGATAAATCAGGCTCCACAATTACTGCTGAGATCCAGGGGGTGATTGATGCCTGTGTC
AAGCTGACTGGCATGCCAGACCTTACACTTTCCTTCATGAACCCTAGGTTGTTGGATGATGTCAGCTTCC
ATCCTTGTGTTCGTTTCAAACGCTGGGAATCTGAGCGCATCCTCTCCTTCATCCCTCCTGATGGAAACTT
CCGCCTGCTGTCTTACCATGTCAGTGCACAGAATCTGGTTGCAATCCCAGTGTATGTCAAACATAACATC
AGTTTCCGGGACAGTAGTTCCCTTGGACGCTTTGAAATAACGGTGGGACCCAAGCAGACGATGGGGAAGA
CCATTGAGGGAGTGACTGTCACCAGCCAGATGCCCAAGGGGGTCCTGAACATGAGCCTTACTCCATCACA
GGGGACACACACATTCGACCCAGTCACAAAGATGCTGTCTTGGGATGTAGGAAAAATAAATCCACAAAAG
CTACCAAGTTTGAAGGGGACCATGAGTCTTCAGGCTGGAGCTTCCAAACCAGATGAAAACCCCACAATTA
ACCTGCAGTTTAAGATCCAGCAGCTGGCCATTTCTGGACTCAAGGTGAATCGTCTGGATATGTATGGAGA
AAAGTACAAACCCTTTAAGGGCATAAAATACATGACCAAAGCTGGGAAGTTCCAAGTTCGAACCTGA


Restriction Sites NotI-NotI     
ACCN NM_006803
Insert Size 3500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_006803.2, NP_006794.1
RefSeq Size 3624 bp
RefSeq ORF 3624 bp
Locus ID 10947
UniProt ID P53677
Domains Adap_comp_sub
Protein Pathways Lysosome
Gene Summary This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 3 (AP-3), which belongs to the adaptor complexes medium subunits family. The AP-3 complex plays a role in protein trafficking to lysosomes and specialized organelles. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2008]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...