AP3M2 (NM_006803) Human Untagged Clone
CAT#: SC111175
AP3M2 (untagged)-Human adaptor-related protein complex 3, mu 2 subunit (AP3M2), transcript variant 2
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AP47B; CLA20; P47B |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_006803, the custom clone sequence may differ by one or more nucleotides
ATGATCCATAGTCTTTTCTTGATCAACTCCTCTGGAGACATTTTCCTGGAGAAACATTGGAAAAGTGTGG TCAGCCGTTCTGTTTGTGATTACTTTTTTGAGGCGCAAGAGAGAGCTACTGAGGCAGAAAATGTGCCTCC GGTTATCCCTACCCCTCACCACTATCTCTTAAGTGTTTACCGCCACAAGATCTTTTTTGTGGCCGTGATC CAGACGGAGGTCCCCCCTCTGTTTGTCATTGAGTTTCTTCACCGAGTGGTGGACACATTTCAGGATTATT TTGGAGTCTGTTCAGAGCCAGTGATCAAAGACAATGTAGTTGTGGTTTATGAGGTATTGGAAGAGATGCT TGACAATGGTTTTCCATTGGCTACCGAGTCGAACATTCTTAAAGAACTCATAAAGCCTCCTACCATCCTT CGAACGGTTGTCAACACCATCACAGGAAGCACGAATGTGGGTGACCAGCTTCCCACTGGGCAGCTGTCAG TGGTGCCTTGGCGACGGACTGGGGTGAAATATACCAACAATGAGGCCTATTTTGATGTGATTGAAGAGAT TGATGCAATTATTGATAAATCAGGCTCCACAATTACTGCTGAGATCCAGGGGGTGATTGATGCCTGTGTC AAGCTGACTGGCATGCCAGACCTTACACTTTCCTTCATGAACCCTAGGTTGTTGGATGATGTCAGCTTCC ATCCTTGTGTTCGTTTCAAACGCTGGGAATCTGAGCGCATCCTCTCCTTCATCCCTCCTGATGGAAACTT CCGCCTGCTGTCTTACCATGTCAGTGCACAGAATCTGGTTGCAATCCCAGTGTATGTCAAACATAACATC AGTTTCCGGGACAGTAGTTCCCTTGGACGCTTTGAAATAACGGTGGGACCCAAGCAGACGATGGGGAAGA CCATTGAGGGAGTGACTGTCACCAGCCAGATGCCCAAGGGGGTCCTGAACATGAGCCTTACTCCATCACA GGGGACACACACATTCGACCCAGTCACAAAGATGCTGTCTTGGGATGTAGGAAAAATAAATCCACAAAAG CTACCAAGTTTGAAGGGGACCATGAGTCTTCAGGCTGGAGCTTCCAAACCAGATGAAAACCCCACAATTA ACCTGCAGTTTAAGATCCAGCAGCTGGCCATTTCTGGACTCAAGGTGAATCGTCTGGATATGTATGGAGA AAAGTACAAACCCTTTAAGGGCATAAAATACATGACCAAAGCTGGGAAGTTCCAAGTTCGAACCTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_006803 |
Insert Size | 3500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006803.2, NP_006794.1 |
RefSeq Size | 3624 bp |
RefSeq ORF | 3624 bp |
Locus ID | 10947 |
UniProt ID | P53677 |
Domains | Adap_comp_sub |
Protein Pathways | Lysosome |
Gene Summary | This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 3 (AP-3), which belongs to the adaptor complexes medium subunits family. The AP-3 complex plays a role in protein trafficking to lysosomes and specialized organelles. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Aug 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208101 | AP3M2 (Myc-DDK-tagged)-Human adaptor-related protein complex 3, mu 2 subunit (AP3M2), transcript variant 2 |
CNY 3,656.00 |
|
RC208101L3 | Lenti-ORF clone of AP3M2 (Myc-DDK-tagged)-Human adaptor-related protein complex 3, mu 2 subunit (AP3M2), transcript variant 2 |
CNY 5,890.00 |
|
RC208101L4 | Lenti-ORF clone of AP3M2 (mGFP-tagged)-Human adaptor-related protein complex 3, mu 2 subunit (AP3M2), transcript variant 2 |
CNY 5,890.00 |
|
RG208101 | AP3M2 (tGFP-tagged) - Human adaptor-related protein complex 3, mu 2 subunit (AP3M2), transcript variant 2 |
CNY 4,370.00 |