Cyclin B3 (CCNB3) (NM_033670) Human Untagged Clone

CAT#: SC110710

CCNB3 (untagged)-Human cyclin B3 (CCNB3), transcript variant 1



  "NM_033670" in other vectors (4)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit Polyclonal Anti-CCNB3 Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CYCB3
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_033670, the custom clone sequence may differ by one or more nucleotides


ATGCTACTGCCACTACCACCCCAGAGCTCCAAACCTGTGCCTAAGAAATCTCAGTCCAGCAAAATTGTGC
CCAGTCATCATGACCCATCTGAAAAGACGGGGGAGAATTGCCAAACGAAGATATCTCCATCTTCACTTCA
GGAGTCTCCATCTTCACTTCAGGGAGCACTCAAAAAGAGATCAGCTTTTGAAGATCTCACTAATGTGTCC
TTTGAGATGACCCATGAGACCCTGTACTTGGCAGTGAAGCTGGTGGATCTCTACCTAATGAAGGCAGTAT
GCAAGAAGGATAAGTTACAACTCCTTGGTGCCACTGCCTTTATGATTGCAGCAAAATTTGAGGAGCACAA
CTCACCTCGTGTGGATGACTTTGTGTACATCTGTGATGATAATTATCAGCGATCTGAGGTACTCAGCATG
GAAATCAACATCCTGAACGTCCTCAAATGTGACATTAACATTCCCATCGCCTACCATTTTCTGCGCAGAT
ATGCTAGGTGTATCCACACCAACATGAAGACACTGACCTTGTCCCGCTACATCTGCGAGATGACCCTGCA
GGAATACCACTATGTCCAGGAGAAGGCTTCCAAGCTAGCTGCTGCCTCCTTACTCCTGGCCCTCTACATG
AAGAAGCTCGGATACTGGGTTCCCTTCCTGGAGCATTACAGTGGCTACAGTATCTCTGAGCTTCACCCCT
TGGTCAGACAGCTGAACAAACTGCTGACTTTCAGTTCTTACGATAGTCTCAAGGCTGTGTATTACAAGTA
TTCTCACCCGGTCTTCTTTGAAGTCGCCAAAATCCCTGCCTTGGATATGTTGAAGCTGGAGGAGATTTTG
AACTGTGATTGTGAGGCTCAGGGCCTGGTACTCTAG


Restriction Sites NotI-NotI     
ACCN NM_033670
Insert Size 2650 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_033670.1, NP_391990.1
RefSeq Size 1212 bp
RefSeq ORF 1212 bp
Locus ID 85417
UniProt ID Q8WWL7
Domains cyclin_C, CYCLIN, cyclin
Protein Families Druggable Genome
Protein Pathways Cell cycle, p53 signaling pathway, Progesterone-mediated oocyte maturation
Gene Summary The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as positive regulators of cyclin-dependent kinases (CDKs), and thereby play an essential role in the control of the cell cycle. Different cyclins exhibit distinct expression and degradation patterns, which contribute to the temporal coordination of each mitotic event. Studies of similar genes in chicken and drosophila suggest that this cyclin may associate with CDC2 and CDK2 kinases, and may be required for proper spindle reorganization and restoration of the interphase nucleus. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (1) lacks four consecutive in-frame coding exons compared to variant 3. This results in a shorter isoform (1) missing a 1104 aa internal protein segment compared to isoform 3.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...