DCTN3 (NM_024348) Human Untagged Clone
CAT#: SC110251
DCTN3 (untagged)-Human dynactin 3 (p22) (DCTN3), transcript variant 2
CNY 2,950.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DCTN-22; DCTN22 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC110251 representing NM_024348.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGGTCTGACTGACTTGCAGCGGCTACAGGCCCGAGTGGAAGAGCTGGAGCGCTGGGTGTACGGG CCGGGCGGGGCGCGCGGCTCACGGAAGGTGGCTGACGGCCTGGTCAAGGTGCAGGTGGCTTTGGGGAAC ATTTCCAGCAAGAGGGAGAGGGTGAAGATTCTCTACAAAAAGATTGAAGATCTGATCAAGTACCTGGAT CCTGAGTACATCGACCGCATTGCCATACCTGATGCCTCTAAGCTGCAATTCATCCTAGCAGAGGAGCAG TTTATCCTTTCCCAGGTTGCACTCCTGGAGCAGGTGAATGCCTTGGTGCCCATGCTGGACAGTGCTCAC ATCAAAGCCGTTCCTGAGCATGCTGCCCGCCTGCAGCGCTTGGCCCAGATCCACATTCAGCAGCAGGCT CCATGGGGAGTGGGAGTCCGTGATGAGGCAGGAAGTTTAGTGGAAGATGTGGGCTTTGCCCAGTTCCTT TCTGTGCTACACTTTGGCCCTACAGGACCAGTGTGTGGAAATCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_024348 |
Insert Size | 531 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_024348.3 |
RefSeq Size | 954 bp |
RefSeq ORF | 531 bp |
Locus ID | 11258 |
UniProt ID | O75935 |
MW | 19.5 kDa |
Gene Summary | This gene encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a translational frameshift, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Interaction of foot-and-mouth disease virus non-structural protein 3A with host protein DCTN3 is important for viral virulence in cattle
,Gladue, DP;O'Donnell, V;Baker-Bransetter, R;Pacheco, JM;Holinka, LG;Arzt, J;Pauszek, S;Fernandez-Sainz, I;Fletcher, P;Brocchi, E;Lu, Z;Rodriguez, LL;Borca, MV;,
J. Virol. Dec 2013.
,PubMed ID 24352458
[DCTN3]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201253 | DCTN3 (Myc-DDK-tagged)-Human dynactin 3 (p22) (DCTN3), transcript variant 2 |
CNY 2,400.00 |
|
RC201253L1 | Lenti ORF clone of Human dynactin 3 (p22) (DCTN3), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC201253L2 | Lenti ORF clone of Human dynactin 3 (p22) (DCTN3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC201253L3 | Lenti ORF clone of Human dynactin 3 (p22) (DCTN3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201253L4 | Lenti ORF clone of Human dynactin 3 (p22) (DCTN3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG201253 | DCTN3 (tGFP-tagged) - Human dynactin 3 (p22) (DCTN3), transcript variant 2 |
CNY 4,000.00 |