DAP12 (TYROBP) (NM_198125) Human Untagged Clone
CAT#: SC109858
TYROBP (untagged)-Human TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant 2
CNY 1,200.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DAP12; KARAP; PLOSL; PLOSL1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_198125, the custom clone sequence may differ by one or more nucleotides
ATGGGGGGACTTGAACCCTGCAGCAGGCTCCTGCTCCTGCCTCTCCTGCTGGCTGTAAGTGGTCTCCGTC CTGTCCAGGCCCAGGCCCAGAGCGATTGCAGTTGCTCTACGGTGAGCCCGGGCGTGCTGGCAGGGATCGT GATGGGAGACCTGGTGCTGACAGTGCTCATTGCCCTGGCCGTGTACTTCCTGGGCCGGCTGGTCCCTCGG GGGCGAGGGGCTGCGGAGGCGACCCGGAAACAGCGTATCACTGAGACCGAGTCGCCTTATCAGGAGCTCC AGGGTCAGAGGTCGGATGTCTACAGCGACCTCAACACACAGAGGCCGTATTACAAATGA >OriGene 5' read for NM_198125 unedited
ATATGCGGCCGCGAATTCGGCACGAGGTGGTGTCCAGCAGCATCCGGCTTCATGGGGGGT CTTGAACCCTGCAGCAGGCTCCTGCTCCTGCCTCTCCTGCTGGCTGTAAGTGGTCTCCGT CCTGTCCAGGCCCAGGCCCAGAGCGATTGCAGTTGCTCTACGGTGAGCCCGGGCGTGCTG GCAGGGATCGTGATGGGAGACCTGGTGCTGACAGTGCTCATTGCCCTGGCCGTGTACTTC CTGGGCCGGCTGGTCCCTCGGGGGCGAGGGGCTGCGGAGGCGACCCGGAAACAGCGTATC ACTGAGACCGAGTCGCCTTATCAGGAGCTCCAGGGTCAGAGGTCGGATGTCTACAGCGAC CTCAACACACAGAGGCCGTATTACAAATGAGCCCGAATCATGACAGTCAGCAACATGATA CCTGGATCCAGCCATTCCTGAAGCCCACCCTGCACCTCATTCCAACTCCTACCGCGATAC AGAACCACAGAGTGCCATCCCTGAGAGACCAGAACGGCTCCCCATTACCTCTCTTAAAAT AAACATTGAGCCCCAAAAAAAAAAAAAAAAAAACCCCGACTCCTAAATTTGCGGCCGCGG TCATAAGTTGTTTCCCTGAACAGATTCCGGGGTGGCATCCCCTGGGACCCCTTCACAATT GGCTTTCCTGGGCCTGGGAATTGCCCATTCCGGTGGCCACCAGCCTTTGCCCAAATAAAT TAAGGTGCCACATTTTGTCGGAAC |
Restriction Sites | NotI-NotI |
ACCN | NM_198125 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_198125.1, NP_937758.1 |
RefSeq Size | 580 bp |
RefSeq ORF | 339 bp |
Locus ID | 7305 |
UniProt ID | O43914 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Natural killer cell mediated cytotoxicity |
Gene Summary | This gene encodes a transmembrane signaling polypeptide which contains an immunoreceptor tyrosine-based activation motif (ITAM) in its cytoplasmic domain. The encoded protein may associate with the killer-cell inhibitory receptor (KIR) family of membrane glycoproteins and may act as an activating signal transduction element. This protein may bind zeta-chain (TCR) associated protein kinase 70kDa (ZAP-70) and spleen tyrosine kinase (SYK) and play a role in signal transduction, bone modeling, brain myelination, and inflammation. Mutations within this gene have been associated with polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLOSL), also known as Nasu-Hakola disease. Its putative receptor, triggering receptor expressed on myeloid cells 2 (TREM2), also causes PLOSL. Multiple alternative transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (2), also known as 112DAP12, uses an alternate in-frame splice site in the coding region, compared to variant 1. The resulting isoform (2) is 1 aa shorter compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203771 | TYROBP (Myc-DDK-tagged)-Human TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant 2 |
CNY 1,200.00 |
|
RC203771L1 | Lenti ORF clone of Human TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC203771L2 | Lenti ORF clone of Human TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC203771L3 | Lenti ORF clone of Human TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC203771L4 | Lenti ORF clone of Human TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant 2, mGFP tagged |
CNY 3,600.00 |
|
RG203771 | TYROBP (tGFP-tagged) - Human TYRO protein tyrosine kinase binding protein (TYROBP), transcript variant 2 |
CNY 2,800.00 |