United States
Germany
Japan
United Kingdom
China
PSMA3 (NM_152132) Human Untagged Clone
CAT＃: SC109641
PSMA3 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 3 (PSMA3), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HC8; PSC3 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_152132, the custom clone sequence may differ by one or more nucleotides
ATGAGCTCAATCGGCACTGGGTATGACCTGTCAGCCTCTACATTCTCTCCTGACGGAAGAGTTTTTCAAG TTGAATATGCTATGAAGGCTGTGGAAAATAGTAGTACAGCTATTGGAATCAGATGCAAAGATGGTGTTGT CTTTGGGGTAGAAAAATTAGTCCTTTCTAAACTTTATGAAGAAGGTTCCAACAAAAGACTTTTTAATGTT GATCGGCATGTTGGAATGGCAGTAGCAGGTTTGTTGGCAGATGCTCGTTCTTTAGCAGACATAGCAAGAG AAGAAGCTTCCAACTTCAGATCTAACTTTGGCTACAACATTCCACTAAAACATCTTGCAGACAGAGTGGC CATGTATGTGCATGCATATACACTCTACAGTGCTGTTAGACCTTTTGGCTGCAGTGTGAATGACGGTGCG CAACTCTACATGATTGACCCATCAGGTGTTTCATACGGTTATTGGGGCTGTGCCATCGGCAAAGCCAGGC AAGCTGCAAAGACGGAAATAGAGAAGCTTCAGATGAAAGAAATGACCTGCCGTGATATCGTTAAAGAAGT TGCAAAAATAATTTACATAGTACATGACGAAGTTAAGGATAAAGCTTTTGAACTAGAACTCAGCTGGGTT GGTGAATTAACTAATGGAAGACATGAAATTGTTCCAAAAGATATAAGAGAAGAAGCAGAGAAATATGCTA AGGAATCTCTGAAGGAAGAAGATGAATCAGATGATGATAATATGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_152132 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_152132.1, NP_687033.1 |
| RefSeq Size | 938 bp |
| RefSeq ORF | 747 bp |
| Locus ID | 5684 |
| UniProt ID | P25788 |
| Domains | proteasome |
| Protein Families | Druggable Genome, Protease, Stem cell - Pluripotency |
| Protein Pathways | Proteasome |
| Gene Summary | The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Two alternative transcripts encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1, resulting in a shorter protein (isoform 2). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202708 | PSMA3 (Myc-DDK-tagged)-Human proteasome (prosome, macropain) subunit, alpha type, 3 (PSMA3), transcript variant 2 |
CNY 2,400.00 |
|
| RC202708L3 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 3 (PSMA3), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202708L4 | Lenti ORF clone of Human proteasome (prosome, macropain) subunit, alpha type, 3 (PSMA3), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG202708 | PSMA3 (tGFP-tagged) - Human proteasome (prosome, macropain) subunit, alpha type, 3 (PSMA3), transcript variant 2 |
CNY 4,370.00 |
|
| SC320835 | PSMA3 (untagged)-Human proteasome (prosome, macropain) subunit, alpha type, 3 (PSMA3), transcript variant 2 |
CNY 2,400.00 |
