United States
Germany
Japan
United Kingdom
China
CDK1 (NM_033379) Human Untagged Clone
CAT＃: SC109041
CDK1 (untagged)-Human cyclin-dependent kinase 1 (CDK1), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CDC2; CDC28A; P34CDC2 |
| Vector | PCMV6-Neo |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_033379 edited
ATGGAAGATTATACCAAAATAGAGAAAATTGGAGAAGGTACCTATGGAGTTGTGTATAAG GGTAGACACAAAACTACAGGTCAAGTGGTAGCCATGAAAAAAATCAGACTAGAAAGTGAA GAGGAAGGGGTTCCTAGTACTGCAATTCGGGAAATTTCTCTATTAAAGGAACTTCGTCAT CCAAATATAGTCAGTCTTCAGGATGTGCTTATGCAGGATTCCAGGTTATATCTCATCTTT GAGTTTCTTTCCATGGATCTGAAGAAATACTTGGATTCTATCCCTCCTGGTCAGTACATG GATTCTTCACTTGTTAAGGTAGTAACACTCTGGTACAGATCTCCAGAAGTATTGCTGGGG TCAGCTCGTTACTCAACTCCAGTTGACATTTGGAGTATAGGCACCATATTTGCTGAACTA GCAACTAAGAAACCACTTTTCCATGGGGATTCAGAAATTGATCAACTCTTCAGGATTTTC AGAGCTTTGGGCACTCCCAATAATGAAGTGTGGCCAGAAGTGGAATCTTTACAGGACTAT AAGAATACATTTCCCAAATGGAAACCAGGAAGCCTAGCATCCCATGTCAAAAACTTGGAT GAAAATGGCTTGGATTTGCTCTCGAAAATGTTAATCTATGATCCAGCCAAACGAATTTCT GGCAAAATGGCACTGAATCATCCATATTTTAATGATTTGGACAATCAGATTAAGAAGATG TAG |
| Chromatograms |
CHROMATOGRAMS
 Sequencher program is needed, download here. |
| Restriction Sites | NotI-NotI |
| ACCN | NM_033379 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_033379.2, NP_203698.1 |
| RefSeq Size | 948 bp |
| RefSeq ORF | 723 bp |
| Locus ID | 983 |
| UniProt ID | P06493 |
| Domains | pkinase, TyrKc, S_TKc |
| Protein Families | Druggable Genome, Protein Kinase, Stem cell - Pluripotency |
| Protein Pathways | Cell cycle, Gap junction, Oocyte meiosis, p53 signaling pathway, Progesterone-mediated oocyte maturation |
| Gene Summary | The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with this protein and function as regulatory subunits. The kinase activity of this protein is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of this protein also play important regulatory roles in cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009] Transcript Variant: This variant (2), also known as CDC2 delta T, lacks an alternate in-frame exon in the middle portion of the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211402 | CDK1 (Myc-DDK-tagged)-Human cyclin-dependent kinase 1 (CDK1), transcript variant 2 |
CNY 2,640.00 |
|
| RC211402L3 | Lenti-ORF clone of CDK1 (Myc-DDK-tagged)-Human cyclin-dependent kinase 1 (CDK1), transcript variant 2 |
CNY 5,890.00 |
|
| RC211402L4 | Lenti-ORF clone of CDK1 (mGFP-tagged)-Human cyclin-dependent kinase 1 (CDK1), transcript variant 2 |
CNY 5,890.00 |
|
| RG211402 | CDK1 (tGFP-tagged) - Human cyclin-dependent kinase 1 (CDK1), transcript variant 2 |
CNY 4,240.00 |
