United States
Germany
Japan
United Kingdom
China
beta Catenin (CTNNB1) (NM_001904) Human Untagged Clone
CAT＃: SC107921
CTNNB1 (untagged)-Human catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 1
CNY 3,600.00
| Cited in 16 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | armadillo; CTNNB; EVR7; MRD19; NEDSDV |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001904, the custom clone sequence may differ by one or more nucleotides
CGGATTATGAAACCGCACTTACTATAGGGCGGCCGCGCAATTCGCACGAGGCCTCGTGCCGAATTCGGCA CGAGGCGGGAGCGGAGAGCGAGGGGAGGCGGAGACGGAGGAAGGTCTGAGGAGCAGCTTCAGTCCCCGCC GAGCCGCCACCGCAGGTCGAGGACGGTCGGACTCCCGCGGCGGGAGGAGCCTGTTCCCCTGAGGGTATTT TTTTTATACCATACAACTGTTTTGAAAATCCAGCGTGGACAATGGCTACTCAAGCTGATTTGATGGAGTT GGACATGGCCATGGAACCAGACAGAAAAGCGGCTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCT GGAATCCATTCTGGTGCCACTACCACAGCTCCTTCTCTGAGTGGTAAAGGCAATCCTGAGGAAGAGGATG TGGATACCTCCCAAGTCCTGTATGAGTGGGAACAGGGATTTTCTCAGTCCTTCACTCAAGAACAAGTAGC TGATATTGATGGACAGTATGCAATGACTCGAGCTCAGAGGGTACGAGCTGCTATGTTCCCTGAGACATTA GATGAGGGCATGCAGATCCCATCTACACAGTTTGATGCTGCTCATCCCACTAATGTCCAGCGTTTGGCTG AACCATCACAGATGCTGAAACATGCAGTTGTAAACTTGATTAACTATCAAGATGATGCAGAACTTGCCAC ACGTGCAATCCCTGAACTGACAAAACTGCTAAATGACGAGGACCAGGTGGTGGTTAATAAGGCTGCAGTT ATGGTCCATCAGCTTTCTAAAAGGAAGCTTCCAGACACGCTATCATGCGTNCTCCTCAGATGGTGTCTGC TATTGTACGTACCATGCCAGATACAAATGATGTAGAAACAGCTCGTTGTACCCGCTGGGACCTTGCATNA CCTTNTCCCANCATGCGTGAGGGCTTACTGGNCCATTTTTAANTCTGGAAGCATTCCTGCCCTTTGTTGA AATGCTG |
| Restriction Sites | NotI-NotI |
| ACCN | NM_001904 |
| Insert Size | 4000 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001904.2, NP_001895.1 |
| RefSeq Size | 3720 bp |
| RefSeq ORF | 987 bp |
| Locus ID | 1499 |
| UniProt ID | P35222 |
| Domains | Armadillo_seg |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Transcription Factors |
| Protein Pathways | Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Basal cell carcinoma, Colorectal cancer, Endometrial cancer, Focal adhesion, Leukocyte transendothelial migration, Melanogenesis, Pathogenic Escherichia coli infection, Pathways in cancer, Prostate cancer, Thyroid cancer, Tight junction, Wnt signaling pathway |
| Gene Summary | The protein encoded by this gene is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. The encoded protein also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, this protein binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Mutations in this gene are a cause of colorectal cancer (CRC), pilomatrixoma (PTR), medulloblastoma (MDB), and ovarian cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same isoform (1). |
Citations (16)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
A two-residue nascent-strand steric gate controls synthesis of 2'-O-methyl- and 2'-O-(2-methoxyethyl)-RNA.
,null,
Nature chemistry
,PubMed ID 36229679
[CTNNB1]
|
|
Glycogen Synthase Kinase-3α Promotes Fatty Acid Uptake and Lipotoxic Cardiomyopathy
,Nakamura, M;Liu, T;Husain, S;Zhai, P;Warren, JS;Hsu, CP;Matsuda, T;Phiel, CJ;Cox, JE;Tian, B;Li, H;Sadoshima, J;,
Cell Metab.
,PubMed ID 30745182
[CTNNB1]
|
|
Gold quantum dots impair the tumorigenic potential of glioma stem-like cells via β-catenin downregulation in vitro
,Wahab, R;Kaushik, N;Khan, F;Kaushik, NK;Lee, SJ;Choi, EH;Al-Khedhairy, AA;,
Int J Nanomedicine
,PubMed ID 30863050
[CTNNB1]
|
|
CXCL9 promotes the progression of diffuse large B-cell lymphoma through up-regulating β-catenin
,Ruiduo, C;Ying, D;Qiwei, W;,
Biomed. Pharmacother.
,PubMed ID 30130730
[CTNNB1]
|
|
Long noncoding RNA MEG3 suppresses liver cancer cells growth through inhibiting β-catenin by activating PKM2 and inactivating PTEN
,Zheng, Q;Lin, Z;Xu, J;Lu, Y;Meng, Q;Wang, C;Yang, Y;Xin, X;Li, X;Pu, H;Gui, X;Li, T;Xiong, W;Lu, D;,
Cell Death Dis
,PubMed ID 29449541
[CTNNB1]
|
|
Regulation of functional KCNQ1OT1 lncRNA by β-catenin
,null,
Scientific Reports
,PubMed ID 26868975
[CTNNB1]
|
|
β-catenin signaling induces the osteoblastogenic differentiation of human pre-osteoblastic and bone marrow stromal cells mainly through the upregulation of osterix expression
,null,
International Journal of Molecular Medicine
,PubMed ID 26496941
[CTNNB1]
|
|
Functional inhibition of ß-catenin-mediated Wnt signalling by intracellular VHH antibodies
,Newnham, LE;Wright, MJ;Holdsworth, G;Kostarelos, K;Robinson, MK;Rabbitts, TH;Lawson, AD;,
MAbs
,PubMed ID 25524068
[CTNNB1]
|
|
Altered Protease-Activated Receptor-1 Expression and Signaling in a Malignant Pleural Mesothelioma Cell Line, NCI-H28, with Homozygous Deletion of the ß-Catenin Gene
,Fazzini, A;D'Antongiovanni, V;Giusti, L;Da Valle, Y;Ciregia, F;Piano, I;Caputo, A;D'Ursi, AM;Gargini, C;Lucacchini, A;Mazzoni, MR;,
PLoS ONE
,PubMed ID 25364818
[CTNNB1]
|
|
Podocalyxin Promotes Glioblastoma Multiforme Cell Invasion and Proliferation via ß-Catenin Signaling
,Liu, Y;Jiang, YG;,
PLoS ONE
,PubMed ID 25349993
[CTNNB1]
|
|
ß-Catenin Activates the HOXA10 and CDX4 Genes in Myeloid Progenitor Cells
,Ling Bei, Chirag Shah, Hao Wang, Weiqi Huang, Rupali Roy, and Elizabeth A. Eklund,
J. Biol. Chem., Nov 2012; 287: 39589 - 39601.
[CTNNB1]
|
|
Negative Cross-talk between Calcium-sensing Receptor and ß-Catenin Signaling Systems in Colonic Epithelium
,Osvaldo Rey, Wenhan Chang, Daniel Bikle, Nora Rozengurt, Steven H. Young, and Enrique Rozengurt,
J. Biol. Chem., Jan 2012; 287: 1158 - 1167.
[CTNNB1]
|
|
Negative Cross-talk between Calcium-sensing Receptor and β-Catenin Signaling Systems in Colonic Epithelium
,null,
The Journal of Biological Chemistry
,PubMed ID 22094462
[CTNNB1]
|
|
Protein kinase C is a positive modulator of canonical Wnt signaling pathway in tumoral colon cell lines
,Luis Bernardo Luna-Ulloa, José G. Hernández-Maqueda, Paula Santoyo-Ramos, M.Cristina Castañeda-Patlán, and Martha Robles-Flores,
Carcinogenesis, Nov 2011; 32: 1615 - 1624.
[CTNNB1]
|
|
The Imprinted Gene PEG3 Inhibits Wnt Signaling and Regulates Glioma Growth
,Xiuli Jiang, Yi Yu, Hong Wei Yang, Nathalie Y. R. Agar, Laura Frado, and Mark D. Johnson,
J. Biol. Chem., Mar 2010; 285: 8472 - 8480
[CTNNB1]
|
|
Targeting PKC: a novel role for beta-catenin in ER stress and apoptotic signaling
,Marc S. Raab, Iris Breitkreutz, Giovanni Tonon, Jing Zhang, Patrick J. Hayden, Thu Nguyen, Johannes H. Fruehauf, Boris K. Lin, Dharminder Chauhan, Teru Hideshima, Nikhil C. Munshi, Kenneth C. Anderson, and Klaus Podar,
Blood, Feb 2009; 113: 1513 - 1521.
[CTNNB1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208947 | CTNNB1 (Myc-DDK-tagged)-Human catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 1 |
CNY 8,576.00 |
|
| RC208947L1 | Lenti ORF clone of Human catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 1, Myc-DDK-tagged |
CNY 10,976.00 |
|
| RC208947L2 | Lenti ORF clone of Human catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 1, mGFP tagged |
CNY 10,976.00 |
|
| RC208947L3 | Lenti ORF clone of Human catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 1, Myc-DDK-tagged |
CNY 10,976.00 |
|
| RC208947L4 | Lenti ORF clone of Human catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 1, mGFP tagged |
CNY 10,976.00 |
|
| RG208947 | CTNNB1 (tGFP-tagged) - Human catenin (cadherin-associated protein), beta 1, 88kDa (CTNNB1), transcript variant 1 |
CNY 10,176.00 |
其它beta Catenin产品
