AJUBA (NM_198086) Human Untagged Clone
CAT#: SC107745
AJUBA (untagged)-Human jub, ajuba homolog (Xenopus laevis) (JUB), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | JUB |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_198086, the custom clone sequence may differ by one or more nucleotides
ATGGGGAAGTCCTATCATCCAGGCTGTTTCCGATGCATTGTTTGCAACAAGTGCCTGGATGGCATCCCCT TCACAGTGGACTTCTCCAACCAAGTATACTGTGTCACCGACTACCACAAAAATTATGCTCCTAAGTGTGC AGCCTGTGGCCAACCCATCCTCCCCTCTGAGGGCTGTGAGGACATCGTGAGGGTGATATCCATGGACCGG GATTATCACTTTGAGTGCTACCACTGTGAGGACTGCCGGATGCAGCTGAGTGATGAGGAAGGCTGCTGCT GTTTCCCTCTGGATGGGCACTTGCTCTGCCATGGTTGCCACATGCAGCGGCTCAATGCCCGACAACCCCC TGCCAACTATATCTGA >OriGene 5' read for NM_198086 unedited
ATTCGGCACGAGCGTGAGGGTGATATCCATGGACCGGGATTATCACTTTGAGTGCTACCA CTGTGAGGACTGCCGGATGCAGCTGAGTGATGAGGAAGGCTGCTGCTGTTTCCCTCTGGA TGGGCACTTGCTCTGCCATGGTTGCCACATGCAGCGGCTCAATGCCCGACAACCCCCTGC CAACTATATCTGAGCTGCAATCACTGCTGCTGCTGTCACCCTGCAGACAAACTGCTGTGG CCAGTGGGCCCCTCTGAGGCCAGCCAAGGCAAAGAATGCACTCTGCAGGCCTGGCAGAAG AGTCCTCTGGGGAGGACCCCAAGGGCCGGAGACCCAAAGATCATGATATTCCAAATGGAT TGTGGAAGAGAAACCTTATATTTACCAGGGTGGGGGCGACTGGCCTTTTTCCCATGTGTG CAGTCTGAGCTTAAGCACACACAGGAGGGTTCCAGGACTTACTGAAGATACAGAATCAGA TGTTCAGTATATATATTTTGTTTGTTTTAGAGATGGGATCTCACCATGTTGCCCAGGCTA GTCTTGAACTCCTGNGCTCGAATGATCCTCCCACCTTGGCCTCCCAAGTGCTGGGATTAT AGGCGTAGCCACTGTGTCTGGCCTAGTGTATGATTATGCATGAGTCACGCAATGTTCTGG TCCTGGGATTCAGGAGTAGAGGACCTAGCTTTAGATCAATTAGTTTCAGCTAAACTGACT GGAACCAGGTTCAAGTGTAATTCTTCCTTCAGCTCCCCCAAACCCCGAGTTTTGGGGN |
Restriction Sites | NotI-NotI |
ACCN | NM_198086 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_198086.1, NP_932352.1 |
RefSeq Size | 3263 bp |
RefSeq ORF | 366 bp |
Locus ID | 84962 |
UniProt ID | Q96IF1 |
Gene Summary | Adapter or scaffold protein which participates in the assembly of numerous protein complexes and is involved in several cellular processes such as cell fate determination, cytoskeletal organization, repression of gene transcription, mitosis, cell-cell adhesion, cell differentiation, proliferation and migration. Contributes to the linking and/or strengthening of epithelia cell-cell junctions in part by linking adhesive receptors to the actin cytoskeleton. May be involved in signal transduction from cell adhesion sites to the nucleus. Plays an important role in regulation of the kinase activity of AURKA for mitotic commitment. Also a component of the IL-1 signaling pathway modulating IL-1-induced NFKB1 activation by influencing the assembly and activity of the PRKCZ-SQSTM1-TRAF6 multiprotein signaling complex. Functions as an HDAC-dependent corepressor for a subset of GFI1 target genes. Acts as a transcriptional corepressor for SNAI1 and SNAI2/SLUG-dependent repression of E-cadherin transcription. Acts as a hypoxic regulator by bridging an association between the prolyl hydroxylases and VHL enabling efficient degradation of HIF1A. Positively regulates microRNA (miRNA)-mediated gene silencing. Negatively regulates the Hippo signaling pathway and antagonizes phosphorylation of YAP1.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215384 | AJUBA (Myc-DDK-tagged)-Human jub, ajuba homolog (Xenopus laevis) (JUB), transcript variant 2 |
CNY 4,016.00 |
|
RC215384L3 | Lenti ORF clone of Human jub, ajuba homolog (Xenopus laevis) (JUB), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215384L4 | Lenti ORF clone of Human jub, ajuba homolog (Xenopus laevis) (JUB), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG215384 | AJUBA (tGFP-tagged) - Human jub, ajuba homolog (Xenopus laevis) (JUB), transcript variant 2 |
CNY 5,616.00 |