TCEB2 (BC013306) Human Untagged Clone

CAT#: SC105940

TCEB2 (untagged)-Homo sapiens, Similar to transcription elongation factor B (SIII), polypeptide 2 (18kD, elongin B), clone MGC:4486 IMAGE:2963043, complete cds



CNY 1,200.00

CNY 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TCEB2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ELOB; elongin, 18-kD subunit; elongin B; RNA polymerase II transcription factor SIII p18 subunit; SIII; SIII p18; transcription elongation factor B (SIII), polypeptide 2 (18kD, elongin B); transcription elongation factor B (SIII), polypeptide 2 (18kDa, el
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for BC013306, the custom clone sequence may differ by one or more nucleotides


ATGGACGTGTTCCTCATGATCCGGCGCCACAAGACCACCATCTTCACGGACGCCAAGGAGTCCAGCACGG
TGTTCGAACTGAAGCGCATCGTCGAGGGCATCCTCAAGCGGCCTCCTGACGAGCAGCGGCTGTACAAGGA
TGACCAACTCTTGGATGATGGCAAGACACTGGGCGAGTGTGGCTTCACCAGTCAAACAGCACGGCCACAG
GCCCCAGCCACAGTGGGGCTGGCCTTCCGGGCAGATGACACCTTTGAGGCCCTGTGCATCGAGCCGTTTT
CCAGCCCGCCAGAGCTGCCCGATGTGATGAAGCCCCAGGACTCGGGAAGCAGTGCCAATGAACAAGCCGT
GCAGTGA


>OriGene 5' read for BC013306 unedited
CACCAGGCAGCAGCCGCGATGGACGTGTTCCTCATGATCCGGCGCCACAAGACCACCATC
TTCACGGACGCCAAGGAGTCCAGCACGGTGTTCGAACTGAAGCGCATCGTCGAGGGCATC
CTCAAGCGGCCTCCTGACGAGCAGCGGCTGTACAAGGATGACCAACTCTTGGATGATGGC
AAGACACTGGGCGAGTGTGGCTTCACCAGTCAAACAGCACGGCCACAGGCCCCAGCCACA
GTGGGGCTGGCCTTCCGGGCAGATGACACCTTTGAGGCCCTGTGCATCGAGCCGTTTTCC
AGCCCGCCAGAGCTGCCCGATGTGATGAAGCCCCAGGACTCGGGAAGCAGTGCCAATGAA
CAAGCCGTGCAGTGAGGACCCCCAAGAGGCCCATTTCCCCCAATAAAAGAGATTTGGGAG
TCTGNNNAAAAAAAAAAAAANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAN
Restriction Sites NotI-NotI     
ACCN BC013306
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC013306.2, AAH13306.1
RefSeq Size 962 bp
RefSeq ORF 357 bp
Locus ID 6923
Domains UBQ
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Pathways in cancer, Renal cell carcinoma, Ubiquitin mediated proteolysis
Gene Summary This gene encodes the protein elongin B, which is a subunit of the transcription factor B (SIII) complex. The SIII complex is composed of elongins A/A2, B and C. It activates elongation by RNA polymerase II by suppressing transient pausing of the polymerase at many sites within transcription units. Elongin A functions as the transcriptionally active component of the SIII complex, whereas elongins B and C are regulatory subunits. Elongin A2 is specifically expressed in the testis, and capable of forming a stable complex with elongins B and C. The von Hippel-Lindau tumor suppressor protein binds to elongins B and C, and thereby inhibits transcription elongation. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. Pseudogenes have been identified on chromosomes 11 and 13. [provided by RefSeq, Aug 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...