GSTM4 (NM_147148) Human Untagged Clone

CAT#: SC101187

GSTM4 (untagged)-Human glutathione S-transferase mu 4 (GSTM4), transcript variant 2



  "NM_147148" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GSTM4 rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GSTM4-4; GTM4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_147148, the custom clone sequence may differ by one or more nucleotides


ATGTCCATGACACTGGGGTACTGGGACATCCGCGGGCTGGCCCACGCCATCCGCCTGCTCCTGGAATACA
CAGACTCAAGCTACGAGGAAAAGAAGTATACGATGGGGGACGCTCCTGACTATGACAGAAGCCAGTGGCT
GAATGAAAAATTCAAGCTGGGCCTGGACTTTCCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATC
ACCCAGAGCAACGCCATCCTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGGAGACAGAAGAGGAGA
AGATTCGTGTGGACATTTTGGAGAACCAGGCTATGGACGTCTCCAATCAGCTGGCCAGAGTCTGCTACAG
CCCTGACTTTGAGAAACTGAAGCCAGAATACTTGGAGGAACTTCCTACAATGATGCAGCACTTCTCACAG
TTCCTGGGGAAGAGGCCATGGTTTGTTGGAGACAAGATCACCTTTGTAGATTTCCTCGCCTATGATGTCC
TTGACCTCCACCGTATATTTGAGCCCAACTGCTTGGACGCCTTTCCAAATCTGAAGGACTTCATCTCCCG
CTTTGAGGTTTCCTGTGGCATAATGTGA


>OriGene 5' read for NM_147148 unedited
CTCATTCACCCGCCCGTTGNAGCAAAGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATA
AGCAGAGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCG
CGAATTCGGCACGAGACTCCTTCCAGCCAGTGAGGATCCAGCAACCTGCTCCGTGCCTCC
CGCGCCTGTTGGTTGGAAGTGACGACCTTGAAGATCGGCCGGTTGGAAGTGACGACCTTG
AAGATCGGCGGGCGCAGCGGGGCCGAGGGGGCGGGTCTGGCGCTAGGTCCAGCCCCTGCG
TGCCGGGAACCCCAGAGGAGGTCGCAGTTCAGCCCAGCTGAGGCCTGTCTGCAGAATCGA
CACCAACCAGCATCATGTCCATGACACTGGGGTACTGGGACATCCGCGGGCTGGCCCACG
CCATCCGCCTGCTCCTGGAATACACAGACTCAAGCTACGAGGAAAAGAAGTATACGATGG
GGGACGCTCCTGACTATGACAGAAGCCAGTGGCTGAATGAAAATTCAAGCTGGGCCTGGA
CTTTTCCAATCTGCCCTACTTGATTGATGGGGCTCACAAGATCACCCAGAGCAACGCCAT
CCTGTGCTACATTGCCCGCAAGCACAACCTGTGTGGGGAGACAGAAGAAGAGAAGATTCG
TGTGGACATTTTGGAGAACCAGCTATGGACGTCTNCAATCAGCTGGCCAGAGTCTGCTAC
AGCCCTGACTTTGANGAACTGAAGCCCAGATACTTGGAGGAACTTNCTAACATGATGCAG
CACTTCTCACAGTTTCCTGGGNAAGAAGCCATGNTTTGTTGGAGACAAGATCACTTTTGG
AAATTCCCTCGCCTATGAAGTCCTGGACTCCCACGTAATTTTGGACCCACTGCTTGGACC
CTTTCCAAAT
Restriction Sites NotI-NotI     
ACCN NM_147148
Insert Size 1500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_147148.1, NP_671489.1
RefSeq Size 1374 bp
RefSeq ORF 588 bp
Locus ID 2948
UniProt ID Q03013
Domains GST_N, GST_C
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
Gene Summary Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. Multiple transcript variants, each encoding a distinct protein isoform, have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate in-frame exon in the 3' coding region and 3' UTR, compared to variant 1. It encodes a protein which has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...