Hrh3 (NM_001270570) Rat Untagged Clone

CAT#: RN216431

Hrh3 (untagged) - Rat histamine receptor H3 (Hrh3), transcript variant 8



  "NM_001270570" in other vectors (1)

CNY 3,330.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-H3 Histamine Receptor
    • 50 ul

CNY 11,000.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216431 representing NM_001270570
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGAGCGCGCGCCGCCCGACGGGCTGATGAACGCGTCGGGCACTCTGGCCGGAGAGGCGGCGGCTGCAG
GCGGGGCGCGCGGCTTCTCGGCTGCCTGGACCGCTGTCCTGGCTGCGCTCATGGCGCTGCTCATCGTGGC
CACAGTACTGGGCAACGCGCTGGTCATGCTCGCCTTCGTGGCGGATTCGAGCCTCCGCACCCAGAACAAC
TTCTTTCTGCTCAACCTCGCCATCTCCGACTTCCTCGTGGGTGCCTTCTGCATCCCATTGTACGTACCCT
ATGTGCTGACCGGCCGTTGGACCTTCGGCCGGGGCCTCTGCAAGCTGTGGCTGGTGGTAGACTACCTACT
GTGTGCCTCCTCGGTCTTCAACATCGTACTCATCAGCTATGACCGATTCCTGTCAGTCACTCGAGCTGTC
TCCTACAGGGCCCAGCAGGGGGACACGAGACGGGCCGTTCGGAAGATGGCACTGGTGTGGGTGCTGGCCT
TCCTGCTGTATGGGCCTGCCATCCTGAGTTGGGAGTACCTGTCTGGTGGCAGTTCCATCCCCGAGGGCCA
CTGCTATGCTGAGTTCTTCTACAACTGGTACTTTCTCATCACGGCCTCCACCCTCGAGTTCTTCACGCCC
TTCCTCAGCGTTACCTTCTTCAACCTCAGCATCTACCTGAACATCCAGAGGCGCACCCGCCTTCGGCTTG
ATGGGGGCCGTGAGGCTGGCCCAGAACCCCCACCAGATGCCCAGCCCTCGCCACCTCCAGCTCCCCCCAG
CTGCTGGGGCTGCTGGCCAAAAGGGCATGGCGAGGCCATGCCGTTGCACAGGGGCTCCAAGCCATCAGCA
TCTTCAGCATCCCTGGAGAAGCGCATGAAGATGGTGTCCCAGAGCATCACCCAGCGCTTCCGGCTGTCGC
GGGACAAGAAGGTGGCCAAGTCGCTGGCCATCATCGTGAGCATCTTTGGGCTCTGCTGGGCGCCGTACAC
GCTCCTAATGATCATCCGAGCTGCTTGCCATGGCCGCTGCATCCCCGATTACTGA


AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCC
TGGATTACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001270570
Insert Size 1035 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270570.1, NP_001257499.1
RefSeq Size 1956 bp
RefSeq ORF 1035 bp
Locus ID 85268
Gene Summary This gene encodes a histamine H3 receptor that belongs to the superfamily of G-protein coupled receptors. This protein functions as a presynaptic autoreceptor on histamine neurons in the brain, and a presynaptic heteroreceptor in nonhistamine-containing neurons in both the central and peripheral nervous systems. It is deemed a great target for the development of therapeutics for numerous disorders, including obesity, epilepsy, and such cognitive diseases as attention deficit hyperactivity disorder and Alzheimer's disease. Several alternatively spliced transcript variants encoding different isoforms, with different brain expression patterns and signaling properties, have been described for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (8) is alternatively spliced at the 3' end and uses an alternate acceptor splice site at the 3' terminal exon compared to variant 1. The latter causes a frame-shift, and a shorter isoform (8) containing 6 transmembrane domains and missing part of the third intracellular loop compared to isoform H3A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...