Aqp4 (NM_001270558) Rat Untagged Clone

CAT#: RN216200

Aqp4 (untagged) - Rat aquaporin 4 (Aqp4), transcript variant 3



  "NM_001270558" in other vectors (1)

CNY 2,660.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal Anti-Aquaporin 4 (300-314)
    • 50 ul

CNY 11,000.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms AQP-4; Miwc; WCH4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216200 representing NM_001270558
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGAGTGACGGAGCTGCAGCGAGGCGGTGGGGTAAGTGTGGACCTCCCTGCAGCAGAGAGAGCATCATGG
TGGCTTTCAAAGGCGTCTGGACTCAAGCCTTCTGGAAGGCGGTCACAGCAGAGTTCCTGGCCATGCTCAT
CTTTGTTCTGCTCAGCGTGGGATCCACCATTAACTGGGGTGGCTCAGAGAACCCCCTACCTGTGGACATG
GTCCTCATCTCCCTCTGCTTTGGACTCAGCATTGCCACCATGGTTCAGTGCTTCGGCCACATCAGCGGTG
GCCACATCAACCCAGCGGTGACAGTGGCCATGGTGTGCACACGAAAGATCAGCATCGCCAAGTCCGTCTT
CTACATCACTGCGCAGTGCCTGGGGGCCATCATCGGAGCTGGGATCCTCTACCTGGTCACACCCCCCAGC
GTGGTGGGAGGATTGGGAGTCACCACGATCAATTATACCGGAGCCAGCATGAATCCAGCTCGATCCTTTG
GCCCTGCAGTTATCATGGGAAACTGGGAAAACCACTGGATATATTGGGTTGGACCAATCATAGGCGCTGT
GCTGGCAGGTGCACTTTACGAGTATGTCTTCTGTCCTGACGTGGAGCTCAAACGTCGCCTAAAGGAAGCC
TTCAGCAAAGCTGCACAGCAGACGAAAGGGAGCTACATGGAGGTGGAGGACAACCGGAGCCAAGTGGAGA
CAGAAGACTTGATCCTGAAGCCCGGGGTGGTGCATGTGATCGACATTGACCGTGGAGACGAGAAGAAGGG
GAAGGACTCGTCTGGAGAGGTATTATCTTCTGTATGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001270558
Insert Size 807 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001270558.2, NP_001257487.1
RefSeq Size 4845 bp
RefSeq ORF 807 bp
Locus ID 25293
UniProt ID P47863
Gene Summary This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Dec 2015]
Transcript Variant: This variant (3, also known as AQP4b) lacks an in-frame coding exon compared to variant 1. The resulting isoform (3) is shorter, missing an internal protein segment compared to isoform M1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...