Gnas (NM_001159656) Rat Untagged Clone

CAT#: RN216171

Gnas (untagged) - Rat GNAS complex locus (Gnas), transcript variant 5



  "NM_001159656" in other vectors (1)

CNY 2,570.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms ALEX; G-alpha-8; Gnas1; Gnpas; Nesp55; SCG6
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216171 representing NM_001159656
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGATCGCAGGTCCCGGGCTCATCAGTGGCGCCGAGCTCGCCATAATTACAACGACCTGTGCCCGCCCA
TAGGCCGCCGGGCTGCTACCGCTCTCCTCTGGCTCTCCTGCTCCATCGCTCTCCTCCGCGCCCTAGCCTC
TTCCAACGCCCGCGCCCAGCAGCGGGCTGCCCAGCGCCGGAGCTTCCTTAACGCCCACCACCGCTCCGCT
GCCGCTGCAGCTGCCGCACAGGTACTCCCCGAGTCCTCTGAATCCGAATCTGATCACGAGCACGAGGAGG
CTGAGCCTGAGCTGGCCCGCCCCGAGTGCCTAGAGTACGATCAGGACGACTACGAGACCGAGACCGATTC
TGAGACCGAGCCTGAGTCCGATATCCAGTCCGAGACCGAATTCGAGACCGAGCCTGAGACCGAGCCTGAG
ACCGCCCCTACAACTGAGCCTGAGACCGAACCAGAGGACGAGCGCGGCCCCCGGGGCGCCACCTTCAACC
AGTCACTCACTCAGCGTCTGCACGCTCTGAAGTTGCAGAGCGCCGACGCCTCCCCGAGACGTGCGCAGCC
CACCACTCAGGAGCCTGAGAGCGCAAGCGAGGGGGAGGAGCCCCAGCGCGAGCCCTTAGACGAGGATCCT
CGGGACCCCGAGGAGTCAGAGGAGCTCAGGGAGGCGAACAGGCAGCCCCGCCGCTGCAAGACCAGGAGGC
CAGCCCGCCGTCGCGACCAGTCCCCGGAGTCCCCTCCCAGAAAGGGGCCCATCCCCATCCGGCGTCACTA
A


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001159656
Insert Size 771 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001159656.1, NP_001153128.1
RefSeq Size 1654 bp
RefSeq ORF 771 bp
Locus ID 24896
UniProt ID Q792G6
Gene Summary This locus has a highly complex imprinted expression pattern. It gives rise to maternally, paternally, and biallelically expressed transcripts that are derived from four alternative promoters and 5' exons. Some transcripts contain a differentially methylated region (DMR) at their 5' exons, and this DMR is commonly found in imprinted genes and correlates with transcript expression. In addition, one of the transcripts contains a second overlapping ORF, which encodes a structurally unrelated protein - Alex. Alternative splicing of downstream exons is also observed, which results in different forms of the stimulatory G-protein alpha subunit, a key element of the classical signal transduction pathway linking receptor-ligand interactions with the activation of adenylyl cyclase and a variety of cellular reponses. Multiple transcript variants have been found for this gene. [provided by RefSeq, Apr 2009]
Transcript Variant: This variant (5) is maternally expressed. It lacks several 3' exons and has alternate 5' and 3' exons, as compared to variant 3. Variants 4 and 5 both encode neuroendocrine secretory protein 55 (NESP55), which localizes to large secretory vesicles of endocrine cells and neurons. The coding regions of variants 4 and 5 do not overlap the coding regions used by other transcripts; thus NESP55 has no similarity to isoforms of the G-protein alpha subunit.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...