Ngf (NM_001277055) Rat Untagged Clone

CAT#: RN216118

Ngf (untagged) - Rat nerve growth factor (beta polypeptide) (Ngf)



  "NM_001277055" in other vectors (1)

CNY 2,380.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal Anti-proNGF
    • 50 ul

CNY 11,000.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Rat Untagged Clone
Tag Tag Free
Synonyms beta-NGF; Ngfb
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>RN216118 representing NM_001277055
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGTCCATGTTGTTCTACACTCTGATCACAGCGTTTTTGATCGGCGTACAGGCAGAACCGTACACAGATA
GCAATGTCCCAGAGGGAGACTCTGTCCCTGAAGCCCACTGGACTAAACTTCAGCATTCCCTTGACACAGC
CCTCCGCAGAGCCCGCAGTGCCCCTGCTGAACCAATAGCTGCCCGTGTGACAGGGCAGACCCGCAACATC
ACTGTGGACCCCAAACTGTTTAAGAAACGGAGACTCCGTTCACCCCGCGTGCTGTTTAGCACCCAGCCTC
CACCCACCTCTTCGGACACTCTGGATTTAGACTTCCAGGCCCATGGTACAATCTCCTTCAACAGGACTCA
CAGGAGCAAGCGCTCATCCACCCACCCAGTCTTCCACATGGGGGAGTTTTCAGTGTGTGACAGTGTCAGT
GTGTGGGTTGGAGATAAGACCACAGCCACGGACATCAAGGGCAAGGAGGTGACAGTGCTGGGCGAGGTGA
ACATTAACAACAGTGTATTCAAACAGTATTTTTTTGAGACCAAGTGCCGAGCCCCGAATCCTGTAGAGAG
TGGATGCCGGGGCATTGACTCCAAGCACTGGAACTCATACTGCACCACGACTCACACCTTTGTCAAGGCG
TTGACAACAGACGACAAACAGGCTGCCTGGAGGTTCATCAGGATAGATACAGCCTGCGTGTGTGTGCTCA
GCAGGAAGGCTGCAAGAAGAGGCTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001277055
Insert Size 726 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001277055.1, NP_001263984.1
RefSeq Size 1075 bp
RefSeq ORF 726 bp
Locus ID 310738
UniProt ID P25427
Gene Summary Nerve growth factor is important for the development and maintenance of the sympathetic and sensory nervous systems. Extracellular ligand for the NTRK1 and NGFR receptors, activates cellular signaling cascades to regulate neuronal proliferation, differentiation and survival (By similarity). The immature NGF precursor (proNGF) functions as ligand for the heterodimeric receptor formed by SORCS2 and NGFR, and activates cellular signaling cascades that lead to inactivation of RAC1 and/or RAC2, reorganization of the actin cytoskeleton and neuronal growth cone collapse. In contrast to mature NGF, the precursor form (proNGF) promotes neuronal apoptosis (in vitro) (By similarity). Inhibits metalloproteinase-dependent proteolysis of platelet glycoprotein VI (By similarity). Binds lysophosphatidylinositol and lysophosphatidylserine between the two chains of the homodimer. The lipid-bound form promotes histamine relase from mast cells, contrary to the lipid-free form (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...